ID: 919236738

View in Genome Browser
Species Human (GRCh38)
Location 1:194855296-194855318
Sequence AAAAAATTAGCTGGGCGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 631458
Summary {0: 12832, 1: 74490, 2: 167805, 3: 193889, 4: 182442}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919236734_919236738 -2 Left 919236734 1:194855275-194855297 CCTTGTCTTTACTAAAAATACAA 0: 1957
1: 69203
2: 164157
3: 184952
4: 112746
Right 919236738 1:194855296-194855318 AAAAAATTAGCTGGGCGTGGTGG 0: 12832
1: 74490
2: 167805
3: 193889
4: 182442
919236733_919236738 17 Left 919236733 1:194855256-194855278 CCTGGCTAACATGGTGAAACCTT 0: 229
1: 8711
2: 72498
3: 185303
4: 195141
Right 919236738 1:194855296-194855318 AAAAAATTAGCTGGGCGTGGTGG 0: 12832
1: 74490
2: 167805
3: 193889
4: 182442
919236732_919236738 21 Left 919236732 1:194855252-194855274 CCATCCTGGCTAACATGGTGAAA 0: 20052
1: 73412
2: 150082
3: 168644
4: 142970
Right 919236738 1:194855296-194855318 AAAAAATTAGCTGGGCGTGGTGG 0: 12832
1: 74490
2: 167805
3: 193889
4: 182442

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919236738 Original CRISPR AAAAAATTAGCTGGGCGTGG TGG Intergenic
Too many off-targets to display for this crispr