ID: 919236739

View in Genome Browser
Species Human (GRCh38)
Location 1:194855299-194855321
Sequence AAATTAGCTGGGCGTGGTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 191256
Summary {0: 10244, 1: 39956, 2: 61717, 3: 51309, 4: 28030}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919236734_919236739 1 Left 919236734 1:194855275-194855297 CCTTGTCTTTACTAAAAATACAA 0: 1957
1: 69203
2: 164157
3: 184952
4: 112746
Right 919236739 1:194855299-194855321 AAATTAGCTGGGCGTGGTGGCGG 0: 10244
1: 39956
2: 61717
3: 51309
4: 28030
919236733_919236739 20 Left 919236733 1:194855256-194855278 CCTGGCTAACATGGTGAAACCTT 0: 229
1: 8711
2: 72498
3: 185303
4: 195141
Right 919236739 1:194855299-194855321 AAATTAGCTGGGCGTGGTGGCGG 0: 10244
1: 39956
2: 61717
3: 51309
4: 28030
919236732_919236739 24 Left 919236732 1:194855252-194855274 CCATCCTGGCTAACATGGTGAAA 0: 20052
1: 73412
2: 150082
3: 168644
4: 142970
Right 919236739 1:194855299-194855321 AAATTAGCTGGGCGTGGTGGCGG 0: 10244
1: 39956
2: 61717
3: 51309
4: 28030

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919236739 Original CRISPR AAATTAGCTGGGCGTGGTGG CGG Intergenic
Too many off-targets to display for this crispr