ID: 919236740

View in Genome Browser
Species Human (GRCh38)
Location 1:194855300-194855322
Sequence AATTAGCTGGGCGTGGTGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248728
Summary {0: 10174, 1: 43081, 2: 75581, 3: 71688, 4: 48204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919236734_919236740 2 Left 919236734 1:194855275-194855297 CCTTGTCTTTACTAAAAATACAA 0: 1957
1: 69203
2: 164157
3: 184952
4: 112746
Right 919236740 1:194855300-194855322 AATTAGCTGGGCGTGGTGGCGGG 0: 10174
1: 43081
2: 75581
3: 71688
4: 48204
919236733_919236740 21 Left 919236733 1:194855256-194855278 CCTGGCTAACATGGTGAAACCTT 0: 229
1: 8711
2: 72498
3: 185303
4: 195141
Right 919236740 1:194855300-194855322 AATTAGCTGGGCGTGGTGGCGGG 0: 10174
1: 43081
2: 75581
3: 71688
4: 48204
919236732_919236740 25 Left 919236732 1:194855252-194855274 CCATCCTGGCTAACATGGTGAAA 0: 20052
1: 73412
2: 150082
3: 168644
4: 142970
Right 919236740 1:194855300-194855322 AATTAGCTGGGCGTGGTGGCGGG 0: 10174
1: 43081
2: 75581
3: 71688
4: 48204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919236740 Original CRISPR AATTAGCTGGGCGTGGTGGC GGG Intergenic
Too many off-targets to display for this crispr