ID: 919236741

View in Genome Browser
Species Human (GRCh38)
Location 1:194855319-194855341
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919236734_919236741 21 Left 919236734 1:194855275-194855297 CCTTGTCTTTACTAAAAATACAA 0: 1957
1: 69203
2: 164157
3: 184952
4: 112746
Right 919236741 1:194855319-194855341 CGGGCACCTACATTCCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr