ID: 919236742

View in Genome Browser
Species Human (GRCh38)
Location 1:194855323-194855345
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919236734_919236742 25 Left 919236734 1:194855275-194855297 CCTTGTCTTTACTAAAAATACAA No data
Right 919236742 1:194855323-194855345 CACCTACATTCCCCTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type