ID: 919236742 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:194855323-194855345 |
| Sequence | CACCTACATTCCCCTGAGGC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 919236734_919236742 | 25 | Left | 919236734 | 1:194855275-194855297 | CCTTGTCTTTACTAAAAATACAA | 0: 1957 1: 69203 2: 164157 3: 184952 4: 112746 |
||
| Right | 919236742 | 1:194855323-194855345 | CACCTACATTCCCCTGAGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 919236742 | Original CRISPR | CACCTACATTCCCCTGAGGC AGG | Intergenic | ||
| No off target data available for this crispr | |||||