ID: 919239630

View in Genome Browser
Species Human (GRCh38)
Location 1:194895919-194895941
Sequence AAAAATCTCAATTTTAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919239630_919239634 3 Left 919239630 1:194895919-194895941 CCCAGCCTAAAATTGAGATTTTT No data
Right 919239634 1:194895945-194895967 TTGCACAGAAAGTTGAATTAGGG No data
919239630_919239633 2 Left 919239630 1:194895919-194895941 CCCAGCCTAAAATTGAGATTTTT No data
Right 919239633 1:194895944-194895966 ATTGCACAGAAAGTTGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919239630 Original CRISPR AAAAATCTCAATTTTAGGCT GGG (reversed) Intergenic