ID: 919241775

View in Genome Browser
Species Human (GRCh38)
Location 1:194924240-194924262
Sequence GACAGCTATTGGCCTGTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919241772_919241775 11 Left 919241772 1:194924206-194924228 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 919241775 1:194924240-194924262 GACAGCTATTGGCCTGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919241775 Original CRISPR GACAGCTATTGGCCTGTTAA TGG Intergenic
No off target data available for this crispr