ID: 919245525

View in Genome Browser
Species Human (GRCh38)
Location 1:194978113-194978135
Sequence AAAAATACACATATGCGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919245525_919245531 22 Left 919245525 1:194978113-194978135 CCCAGCCGCATATGTGTATTTTT No data
Right 919245531 1:194978158-194978180 TTCTGGTACATGCCCAATAATGG No data
919245525_919245529 5 Left 919245525 1:194978113-194978135 CCCAGCCGCATATGTGTATTTTT No data
Right 919245529 1:194978141-194978163 AGAATAATTTATATTCCTTCTGG No data
919245525_919245532 23 Left 919245525 1:194978113-194978135 CCCAGCCGCATATGTGTATTTTT No data
Right 919245532 1:194978159-194978181 TCTGGTACATGCCCAATAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919245525 Original CRISPR AAAAATACACATATGCGGCT GGG (reversed) Intergenic
No off target data available for this crispr