ID: 919249712

View in Genome Browser
Species Human (GRCh38)
Location 1:195037568-195037590
Sequence CAGTATAAGTAGTGGGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919249709_919249712 -1 Left 919249709 1:195037546-195037568 CCTTTAAAAGTTTTTAGAGTATC No data
Right 919249712 1:195037568-195037590 CAGTATAAGTAGTGGGTGTATGG No data
919249708_919249712 11 Left 919249708 1:195037534-195037556 CCTGTTTAATGTCCTTTAAAAGT No data
Right 919249712 1:195037568-195037590 CAGTATAAGTAGTGGGTGTATGG No data
919249707_919249712 12 Left 919249707 1:195037533-195037555 CCCTGTTTAATGTCCTTTAAAAG No data
Right 919249712 1:195037568-195037590 CAGTATAAGTAGTGGGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919249712 Original CRISPR CAGTATAAGTAGTGGGTGTA TGG Intergenic
No off target data available for this crispr