ID: 919256317

View in Genome Browser
Species Human (GRCh38)
Location 1:195129074-195129096
Sequence GGAAACAGAGCATAAAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4509
Summary {0: 171, 1: 919, 2: 1318, 3: 1067, 4: 1034}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919256317_919256322 29 Left 919256317 1:195129074-195129096 CCAAACTTTTATGCTCTGTTTCC 0: 171
1: 919
2: 1318
3: 1067
4: 1034
Right 919256322 1:195129126-195129148 TTCTCTGTGAATATATAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919256317 Original CRISPR GGAAACAGAGCATAAAAGTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr