ID: 919256317 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:195129074-195129096 |
| Sequence | GGAAACAGAGCATAAAAGTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 4509 | |||
| Summary | {0: 171, 1: 919, 2: 1318, 3: 1067, 4: 1034} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 919256317_919256322 | 29 | Left | 919256317 | 1:195129074-195129096 | CCAAACTTTTATGCTCTGTTTCC | 0: 171 1: 919 2: 1318 3: 1067 4: 1034 |
||
| Right | 919256322 | 1:195129126-195129148 | TTCTCTGTGAATATATAAAACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 919256317 | Original CRISPR | GGAAACAGAGCATAAAAGTT TGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||