ID: 919256318

View in Genome Browser
Species Human (GRCh38)
Location 1:195129095-195129117
Sequence ATTGGAACTTATGTTTAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2589
Summary {0: 272, 1: 405, 2: 533, 3: 528, 4: 851}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919256318_919256322 8 Left 919256318 1:195129095-195129117 CCCTTTTAAACATAAGTTCCAAT 0: 272
1: 405
2: 533
3: 528
4: 851
Right 919256322 1:195129126-195129148 TTCTCTGTGAATATATAAAACGG No data
919256318_919256323 30 Left 919256318 1:195129095-195129117 CCCTTTTAAACATAAGTTCCAAT 0: 272
1: 405
2: 533
3: 528
4: 851
Right 919256323 1:195129148-195129170 GAATGCTTTTAAGAGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919256318 Original CRISPR ATTGGAACTTATGTTTAAAA GGG (reversed) Intergenic
Too many off-targets to display for this crispr