ID: 919256318 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:195129095-195129117 |
| Sequence | ATTGGAACTTATGTTTAAAA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2589 | |||
| Summary | {0: 272, 1: 405, 2: 533, 3: 528, 4: 851} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 919256318_919256322 | 8 | Left | 919256318 | 1:195129095-195129117 | CCCTTTTAAACATAAGTTCCAAT | 0: 272 1: 405 2: 533 3: 528 4: 851 |
||
| Right | 919256322 | 1:195129126-195129148 | TTCTCTGTGAATATATAAAACGG | No data | ||||
| 919256318_919256323 | 30 | Left | 919256318 | 1:195129095-195129117 | CCCTTTTAAACATAAGTTCCAAT | 0: 272 1: 405 2: 533 3: 528 4: 851 |
||
| Right | 919256323 | 1:195129148-195129170 | GAATGCTTTTAAGAGCACCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 919256318 | Original CRISPR | ATTGGAACTTATGTTTAAAA GGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||