ID: 919256319

View in Genome Browser
Species Human (GRCh38)
Location 1:195129096-195129118
Sequence AATTGGAACTTATGTTTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2628
Summary {0: 279, 1: 446, 2: 580, 3: 547, 4: 776}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919256319_919256323 29 Left 919256319 1:195129096-195129118 CCTTTTAAACATAAGTTCCAATT 0: 279
1: 446
2: 580
3: 547
4: 776
Right 919256323 1:195129148-195129170 GAATGCTTTTAAGAGCACCCAGG No data
919256319_919256322 7 Left 919256319 1:195129096-195129118 CCTTTTAAACATAAGTTCCAATT 0: 279
1: 446
2: 580
3: 547
4: 776
Right 919256322 1:195129126-195129148 TTCTCTGTGAATATATAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919256319 Original CRISPR AATTGGAACTTATGTTTAAA AGG (reversed) Intergenic
Too many off-targets to display for this crispr