ID: 919256320

View in Genome Browser
Species Human (GRCh38)
Location 1:195129113-195129135
Sequence TCACAGAGAAGGTTTGAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919256320_919256322 -10 Left 919256320 1:195129113-195129135 CCAATTTCAAACCTTCTCTGTGA No data
Right 919256322 1:195129126-195129148 TTCTCTGTGAATATATAAAACGG No data
919256320_919256323 12 Left 919256320 1:195129113-195129135 CCAATTTCAAACCTTCTCTGTGA No data
Right 919256323 1:195129148-195129170 GAATGCTTTTAAGAGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919256320 Original CRISPR TCACAGAGAAGGTTTGAAAT TGG (reversed) Intergenic
No off target data available for this crispr