ID: 919256322

View in Genome Browser
Species Human (GRCh38)
Location 1:195129126-195129148
Sequence TTCTCTGTGAATATATAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919256320_919256322 -10 Left 919256320 1:195129113-195129135 CCAATTTCAAACCTTCTCTGTGA No data
Right 919256322 1:195129126-195129148 TTCTCTGTGAATATATAAAACGG No data
919256317_919256322 29 Left 919256317 1:195129074-195129096 CCAAACTTTTATGCTCTGTTTCC 0: 171
1: 919
2: 1318
3: 1067
4: 1034
Right 919256322 1:195129126-195129148 TTCTCTGTGAATATATAAAACGG No data
919256318_919256322 8 Left 919256318 1:195129095-195129117 CCCTTTTAAACATAAGTTCCAAT 0: 272
1: 405
2: 533
3: 528
4: 851
Right 919256322 1:195129126-195129148 TTCTCTGTGAATATATAAAACGG No data
919256319_919256322 7 Left 919256319 1:195129096-195129118 CCTTTTAAACATAAGTTCCAATT 0: 279
1: 446
2: 580
3: 547
4: 776
Right 919256322 1:195129126-195129148 TTCTCTGTGAATATATAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919256322 Original CRISPR TTCTCTGTGAATATATAAAA CGG Intergenic
No off target data available for this crispr