ID: 919263367

View in Genome Browser
Species Human (GRCh38)
Location 1:195228241-195228263
Sequence CTTGCTATCCAGGCTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919263363_919263367 -4 Left 919263363 1:195228222-195228244 CCGCTAATGGTAATGTCACCTTG No data
Right 919263367 1:195228241-195228263 CTTGCTATCCAGGCTGATATGGG No data
919263361_919263367 9 Left 919263361 1:195228209-195228231 CCAAATTTCTTTACCGCTAATGG No data
Right 919263367 1:195228241-195228263 CTTGCTATCCAGGCTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919263367 Original CRISPR CTTGCTATCCAGGCTGATAT GGG Intergenic
No off target data available for this crispr