ID: 919267156

View in Genome Browser
Species Human (GRCh38)
Location 1:195284340-195284362
Sequence AAACAGACAATGTACAGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21054
Summary {0: 10, 1: 182, 2: 1779, 3: 4241, 4: 14842}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919267156_919267158 29 Left 919267156 1:195284340-195284362 CCCATTCTGTACATTGTCTGTTT 0: 10
1: 182
2: 1779
3: 4241
4: 14842
Right 919267158 1:195284392-195284414 GAAGCTGTTTAGTTTAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919267156 Original CRISPR AAACAGACAATGTACAGAAT GGG (reversed) Intergenic
Too many off-targets to display for this crispr