ID: 919267157

View in Genome Browser
Species Human (GRCh38)
Location 1:195284341-195284363
Sequence TAAACAGACAATGTACAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20923
Summary {0: 10, 1: 166, 2: 1765, 3: 4131, 4: 14851}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919267157_919267158 28 Left 919267157 1:195284341-195284363 CCATTCTGTACATTGTCTGTTTA 0: 10
1: 166
2: 1765
3: 4131
4: 14851
Right 919267158 1:195284392-195284414 GAAGCTGTTTAGTTTAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919267157 Original CRISPR TAAACAGACAATGTACAGAA TGG (reversed) Intergenic
Too many off-targets to display for this crispr