ID: 919267158

View in Genome Browser
Species Human (GRCh38)
Location 1:195284392-195284414
Sequence GAAGCTGTTTAGTTTAGTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919267156_919267158 29 Left 919267156 1:195284340-195284362 CCCATTCTGTACATTGTCTGTTT 0: 10
1: 182
2: 1779
3: 4241
4: 14842
Right 919267158 1:195284392-195284414 GAAGCTGTTTAGTTTAGTTAAGG No data
919267157_919267158 28 Left 919267157 1:195284341-195284363 CCATTCTGTACATTGTCTGTTTA 0: 10
1: 166
2: 1765
3: 4131
4: 14851
Right 919267158 1:195284392-195284414 GAAGCTGTTTAGTTTAGTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919267158 Original CRISPR GAAGCTGTTTAGTTTAGTTA AGG Intergenic
No off target data available for this crispr