ID: 919270285

View in Genome Browser
Species Human (GRCh38)
Location 1:195333003-195333025
Sequence TCCTCATTAAATAAGAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919270283_919270285 -8 Left 919270283 1:195332988-195333010 CCACTGTGACTGGTATCCTCATT No data
Right 919270285 1:195333003-195333025 TCCTCATTAAATAAGAAACTGGG No data
919270282_919270285 -1 Left 919270282 1:195332981-195333003 CCATAATCCACTGTGACTGGTAT No data
Right 919270285 1:195333003-195333025 TCCTCATTAAATAAGAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919270285 Original CRISPR TCCTCATTAAATAAGAAACT GGG Intergenic
No off target data available for this crispr