ID: 919279317

View in Genome Browser
Species Human (GRCh38)
Location 1:195466710-195466732
Sequence GGAAGACCAAAGAGTCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919279317_919279318 -5 Left 919279317 1:195466710-195466732 CCAAGCTGACTCTTTGGTCTTCC No data
Right 919279318 1:195466728-195466750 CTTCCTGAAGTGCCATCGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919279317 Original CRISPR GGAAGACCAAAGAGTCAGCT TGG (reversed) Intergenic
No off target data available for this crispr