ID: 919287067

View in Genome Browser
Species Human (GRCh38)
Location 1:195577616-195577638
Sequence GTACACAAAACAATAATGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919287067_919287070 8 Left 919287067 1:195577616-195577638 CCATTCATTATTGTTTTGTGTAC No data
Right 919287070 1:195577647-195577669 GCTAATTTGACATTATAAAGTGG No data
919287067_919287071 23 Left 919287067 1:195577616-195577638 CCATTCATTATTGTTTTGTGTAC No data
Right 919287071 1:195577662-195577684 TAAAGTGGTATATTGTTATATGG No data
919287067_919287072 24 Left 919287067 1:195577616-195577638 CCATTCATTATTGTTTTGTGTAC No data
Right 919287072 1:195577663-195577685 AAAGTGGTATATTGTTATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919287067 Original CRISPR GTACACAAAACAATAATGAA TGG (reversed) Intergenic
No off target data available for this crispr