ID: 919289882

View in Genome Browser
Species Human (GRCh38)
Location 1:195615751-195615773
Sequence TAAAGATTAGCGAGGCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919289882_919289885 -6 Left 919289882 1:195615751-195615773 CCACCAGGCCTCGCTAATCTTTA No data
Right 919289885 1:195615768-195615790 TCTTTATTGATTACTAGAGATGG No data
919289882_919289888 19 Left 919289882 1:195615751-195615773 CCACCAGGCCTCGCTAATCTTTA No data
Right 919289888 1:195615793-195615815 TCTCCCCATGTTTCTCAGGCTGG No data
919289882_919289887 15 Left 919289882 1:195615751-195615773 CCACCAGGCCTCGCTAATCTTTA No data
Right 919289887 1:195615789-195615811 GGGATCTCCCCATGTTTCTCAGG No data
919289882_919289886 -5 Left 919289882 1:195615751-195615773 CCACCAGGCCTCGCTAATCTTTA No data
Right 919289886 1:195615769-195615791 CTTTATTGATTACTAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919289882 Original CRISPR TAAAGATTAGCGAGGCCTGG TGG (reversed) Intergenic
No off target data available for this crispr