ID: 919289885

View in Genome Browser
Species Human (GRCh38)
Location 1:195615768-195615790
Sequence TCTTTATTGATTACTAGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919289882_919289885 -6 Left 919289882 1:195615751-195615773 CCACCAGGCCTCGCTAATCTTTA No data
Right 919289885 1:195615768-195615790 TCTTTATTGATTACTAGAGATGG No data
919289881_919289885 -5 Left 919289881 1:195615750-195615772 CCCACCAGGCCTCGCTAATCTTT No data
Right 919289885 1:195615768-195615790 TCTTTATTGATTACTAGAGATGG No data
919289877_919289885 26 Left 919289877 1:195615719-195615741 CCTCTGGAGTAGCTGGGACTACA 0: 1343
1: 9711
2: 118750
3: 248813
4: 240255
Right 919289885 1:195615768-195615790 TCTTTATTGATTACTAGAGATGG No data
919289880_919289885 -4 Left 919289880 1:195615749-195615771 CCCCACCAGGCCTCGCTAATCTT No data
Right 919289885 1:195615768-195615790 TCTTTATTGATTACTAGAGATGG No data
919289883_919289885 -9 Left 919289883 1:195615754-195615776 CCAGGCCTCGCTAATCTTTATTG No data
Right 919289885 1:195615768-195615790 TCTTTATTGATTACTAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919289885 Original CRISPR TCTTTATTGATTACTAGAGA TGG Intergenic
No off target data available for this crispr