ID: 919289888

View in Genome Browser
Species Human (GRCh38)
Location 1:195615793-195615815
Sequence TCTCCCCATGTTTCTCAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919289880_919289888 21 Left 919289880 1:195615749-195615771 CCCCACCAGGCCTCGCTAATCTT No data
Right 919289888 1:195615793-195615815 TCTCCCCATGTTTCTCAGGCTGG No data
919289883_919289888 16 Left 919289883 1:195615754-195615776 CCAGGCCTCGCTAATCTTTATTG No data
Right 919289888 1:195615793-195615815 TCTCCCCATGTTTCTCAGGCTGG No data
919289884_919289888 11 Left 919289884 1:195615759-195615781 CCTCGCTAATCTTTATTGATTAC No data
Right 919289888 1:195615793-195615815 TCTCCCCATGTTTCTCAGGCTGG No data
919289881_919289888 20 Left 919289881 1:195615750-195615772 CCCACCAGGCCTCGCTAATCTTT No data
Right 919289888 1:195615793-195615815 TCTCCCCATGTTTCTCAGGCTGG No data
919289882_919289888 19 Left 919289882 1:195615751-195615773 CCACCAGGCCTCGCTAATCTTTA No data
Right 919289888 1:195615793-195615815 TCTCCCCATGTTTCTCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919289888 Original CRISPR TCTCCCCATGTTTCTCAGGC TGG Intergenic
No off target data available for this crispr