ID: 919292991

View in Genome Browser
Species Human (GRCh38)
Location 1:195657655-195657677
Sequence CTTTTTAGACAGGTGTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919292991_919292993 4 Left 919292991 1:195657655-195657677 CCATGTCACACCTGTCTAAAAAG No data
Right 919292993 1:195657682-195657704 ATAACAAATTCAATGAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919292991 Original CRISPR CTTTTTAGACAGGTGTGACA TGG (reversed) Intergenic
No off target data available for this crispr