ID: 919293768

View in Genome Browser
Species Human (GRCh38)
Location 1:195668304-195668326
Sequence GACCTCAACAAAATAATCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919293768_919293773 5 Left 919293768 1:195668304-195668326 CCCCAGATTATTTTGTTGAGGTC No data
Right 919293773 1:195668332-195668354 GCCTAATGCCCATGGTTCTCTGG No data
919293768_919293771 -3 Left 919293768 1:195668304-195668326 CCCCAGATTATTTTGTTGAGGTC No data
Right 919293771 1:195668324-195668346 GTCCAGTAGCCTAATGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919293768 Original CRISPR GACCTCAACAAAATAATCTG GGG (reversed) Intergenic
No off target data available for this crispr