ID: 919311780

View in Genome Browser
Species Human (GRCh38)
Location 1:195918286-195918308
Sequence GCCTAGTGATTCTGCCACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919311776_919311780 21 Left 919311776 1:195918242-195918264 CCCATATCACATGTTCAATTCTT No data
Right 919311780 1:195918286-195918308 GCCTAGTGATTCTGCCACCATGG No data
919311779_919311780 -4 Left 919311779 1:195918267-195918289 CCTGAATGTCAGAAATGAGGCCT No data
Right 919311780 1:195918286-195918308 GCCTAGTGATTCTGCCACCATGG No data
919311777_919311780 20 Left 919311777 1:195918243-195918265 CCATATCACATGTTCAATTCTTA No data
Right 919311780 1:195918286-195918308 GCCTAGTGATTCTGCCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919311780 Original CRISPR GCCTAGTGATTCTGCCACCA TGG Intergenic
No off target data available for this crispr