ID: 919312767

View in Genome Browser
Species Human (GRCh38)
Location 1:195932336-195932358
Sequence GAAAATTTCAGAGACATCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919312767_919312772 21 Left 919312767 1:195932336-195932358 CCAAAGATGTCTCTGAAATTTTC No data
Right 919312772 1:195932380-195932402 TAGGGTATAGTTTACAGAAATGG No data
919312767_919312771 3 Left 919312767 1:195932336-195932358 CCAAAGATGTCTCTGAAATTTTC No data
Right 919312771 1:195932362-195932384 TTGATCAAGTGGGTGAATTAGGG No data
919312767_919312769 -7 Left 919312767 1:195932336-195932358 CCAAAGATGTCTCTGAAATTTTC No data
Right 919312769 1:195932352-195932374 AATTTTCAGTTTGATCAAGTGGG No data
919312767_919312768 -8 Left 919312767 1:195932336-195932358 CCAAAGATGTCTCTGAAATTTTC No data
Right 919312768 1:195932351-195932373 AAATTTTCAGTTTGATCAAGTGG No data
919312767_919312770 2 Left 919312767 1:195932336-195932358 CCAAAGATGTCTCTGAAATTTTC No data
Right 919312770 1:195932361-195932383 TTTGATCAAGTGGGTGAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919312767 Original CRISPR GAAAATTTCAGAGACATCTT TGG (reversed) Intergenic
No off target data available for this crispr