ID: 919313168

View in Genome Browser
Species Human (GRCh38)
Location 1:195937604-195937626
Sequence CGACTACTTATTTGTACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919313168_919313169 18 Left 919313168 1:195937604-195937626 CCTGGAGTACAAATAAGTAGTCG No data
Right 919313169 1:195937645-195937667 AAAATATATATTTTTTGAGATGG 0: 6
1: 67
2: 391
3: 1435
4: 7630

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919313168 Original CRISPR CGACTACTTATTTGTACTCC AGG (reversed) Intergenic
No off target data available for this crispr