ID: 919314513

View in Genome Browser
Species Human (GRCh38)
Location 1:195954486-195954508
Sequence AATTCTATGCAGAAGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919314504_919314513 15 Left 919314504 1:195954448-195954470 CCACTATTTATAATATTGATAGG No data
Right 919314513 1:195954486-195954508 AATTCTATGCAGAAGAGGGAAGG No data
919314503_919314513 28 Left 919314503 1:195954435-195954457 CCTTTCTATAACACCACTATTTA No data
Right 919314513 1:195954486-195954508 AATTCTATGCAGAAGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919314513 Original CRISPR AATTCTATGCAGAAGAGGGA AGG Intergenic
No off target data available for this crispr