ID: 919317976

View in Genome Browser
Species Human (GRCh38)
Location 1:195999398-195999420
Sequence GATAGCTTTTGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919317971_919317976 11 Left 919317971 1:195999364-195999386 CCATCTTCTGCAGATAACTACTC 0: 178
1: 192
2: 102
3: 110
4: 247
Right 919317976 1:195999398-195999420 GATAGCTTTTGGCCTGTTACTGG No data
919317970_919317976 15 Left 919317970 1:195999360-195999382 CCTGCCATCTTCTGCAGATAACT 0: 185
1: 187
2: 104
3: 111
4: 225
Right 919317976 1:195999398-195999420 GATAGCTTTTGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919317976 Original CRISPR GATAGCTTTTGGCCTGTTAC TGG Intergenic
No off target data available for this crispr