ID: 919318282

View in Genome Browser
Species Human (GRCh38)
Location 1:196001918-196001940
Sequence ACAAATAGGCAGAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919318276_919318282 10 Left 919318276 1:196001885-196001907 CCCAATCTAATGAGCTGCCAGTG No data
Right 919318282 1:196001918-196001940 ACAAATAGGCAGAATGTGGAAGG No data
919318275_919318282 30 Left 919318275 1:196001865-196001887 CCACTCTCAATCTGGTTGGGCCC No data
Right 919318282 1:196001918-196001940 ACAAATAGGCAGAATGTGGAAGG No data
919318277_919318282 9 Left 919318277 1:196001886-196001908 CCAATCTAATGAGCTGCCAGTGC No data
Right 919318282 1:196001918-196001940 ACAAATAGGCAGAATGTGGAAGG No data
919318278_919318282 -7 Left 919318278 1:196001902-196001924 CCAGTGCAGCCAGAATACAAATA No data
Right 919318282 1:196001918-196001940 ACAAATAGGCAGAATGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919318282 Original CRISPR ACAAATAGGCAGAATGTGGA AGG Intergenic
No off target data available for this crispr