ID: 919318767

View in Genome Browser
Species Human (GRCh38)
Location 1:196007199-196007221
Sequence ATTCATTTACAGACCGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919318760_919318767 28 Left 919318760 1:196007148-196007170 CCAAGCAAAGGCTATCAGATAGG No data
Right 919318767 1:196007199-196007221 ATTCATTTACAGACCGGGCATGG No data
919318763_919318767 2 Left 919318763 1:196007174-196007196 CCTCTTTTTCTTTCCTGTTAATT No data
Right 919318767 1:196007199-196007221 ATTCATTTACAGACCGGGCATGG No data
919318762_919318767 3 Left 919318762 1:196007173-196007195 CCCTCTTTTTCTTTCCTGTTAAT No data
Right 919318767 1:196007199-196007221 ATTCATTTACAGACCGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919318767 Original CRISPR ATTCATTTACAGACCGGGCA TGG Intergenic
No off target data available for this crispr