ID: 919322328

View in Genome Browser
Species Human (GRCh38)
Location 1:196058844-196058866
Sequence GGGGAGTATTTTTAACCGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919322328_919322333 12 Left 919322328 1:196058844-196058866 CCAAGCGGTTAAAAATACTCCCC No data
Right 919322333 1:196058879-196058901 ATATTACGTTCACCCTTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919322328 Original CRISPR GGGGAGTATTTTTAACCGCT TGG (reversed) Intergenic
No off target data available for this crispr