ID: 919331273

View in Genome Browser
Species Human (GRCh38)
Location 1:196175281-196175303
Sequence TACACTAGACTTCTGAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919331272_919331273 3 Left 919331272 1:196175255-196175277 CCTGAATTGTTCAAGGGTGAACT No data
Right 919331273 1:196175281-196175303 TACACTAGACTTCTGAAGAAAGG No data
919331269_919331273 9 Left 919331269 1:196175249-196175271 CCTAACCCTGAATTGTTCAAGGG No data
Right 919331273 1:196175281-196175303 TACACTAGACTTCTGAAGAAAGG No data
919331271_919331273 4 Left 919331271 1:196175254-196175276 CCCTGAATTGTTCAAGGGTGAAC No data
Right 919331273 1:196175281-196175303 TACACTAGACTTCTGAAGAAAGG No data
919331267_919331273 10 Left 919331267 1:196175248-196175270 CCCTAACCCTGAATTGTTCAAGG No data
Right 919331273 1:196175281-196175303 TACACTAGACTTCTGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919331273 Original CRISPR TACACTAGACTTCTGAAGAA AGG Intergenic
No off target data available for this crispr