ID: 919335982

View in Genome Browser
Species Human (GRCh38)
Location 1:196234442-196234464
Sequence CTATGTAAATAGATTTATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 350}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919335982_919335987 21 Left 919335982 1:196234442-196234464 CCTTCATAAATCTATTTACATAG 0: 1
1: 0
2: 1
3: 14
4: 350
Right 919335987 1:196234486-196234508 TATCTTGATGCTATGACAGATGG 0: 1
1: 0
2: 0
3: 7
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919335982 Original CRISPR CTATGTAAATAGATTTATGA AGG (reversed) Intronic
903611867 1:24620737-24620759 CTAAGTAAGTAGATAGATGAGGG - Intergenic
905710781 1:40100743-40100765 TTATGTACATACATATATGATGG + Intergenic
906621312 1:47282882-47282904 CTATGTACTTATATCTATGATGG + Intronic
907424893 1:54373358-54373380 CTCTGTAACTAGAATCATGAAGG - Intronic
908635285 1:66157034-66157056 CTATCTAAAGAGAGTTAAGAAGG - Intronic
909010291 1:70327056-70327078 CTAGGTAAAAAGCTTTATGCTGG + Intronic
909377277 1:74953695-74953717 CTTTATAAATATATTTATAAGGG - Intergenic
909549207 1:76879089-76879111 CTTGTGAAATAGATTTATGAGGG - Intronic
909789707 1:79660297-79660319 TTATGCAAATAGATTGATGAAGG + Intergenic
909991566 1:82229112-82229134 CTATTGAGATACATTTATGAAGG + Intergenic
910825482 1:91403406-91403428 TTATGTAAATAAAATCATGAAGG + Intronic
910948174 1:92616239-92616261 CTTTTGAAATAGATTTGTGAGGG + Intronic
911171998 1:94780070-94780092 CTAGGTAGAGACATTTATGATGG + Intergenic
911307549 1:96249446-96249468 GTATGTAAATGGATTGCTGATGG - Intergenic
911331178 1:96527331-96527353 CTATGTAAAGTGATGTATTATGG - Intergenic
912016704 1:105047112-105047134 CCAAGTAAGTACATTTATGATGG - Intergenic
914719106 1:150274609-150274631 AAATGAAAAAAGATTTATGATGG + Intronic
914740322 1:150459173-150459195 CTATCTAATAAGATTTATGAAGG - Intronic
914787060 1:150843346-150843368 CTATATAAATATATTTAAAATGG - Intronic
915856525 1:159393565-159393587 CTATAGAAATACATTTAAGAAGG + Intergenic
916127449 1:161583936-161583958 TTATGTAAAGAGTTTTCTGAGGG + Intronic
916137367 1:161665740-161665762 TTATGTAAAGAGTTTTCTGAGGG + Intronic
916909335 1:169328522-169328544 CTAGGTAAATAGTTTTTTAAAGG + Intronic
916981938 1:170147189-170147211 TTTTGTAAATCCATTTATGAGGG + Intronic
919240995 1:194915706-194915728 ATATGTAAACACATTTATAAGGG - Intergenic
919335982 1:196234442-196234464 CTATGTAAATAGATTTATGAAGG - Intronic
920540780 1:206776456-206776478 TTATGCAAATAGATTTTGGAGGG + Intergenic
921940219 1:220831232-220831254 ATATGTAAAGAGATTTATTATGG + Intergenic
922197973 1:223376183-223376205 CAGTGTAAACAGATTTAAGATGG - Intergenic
924623143 1:245679763-245679785 CTTTGAAAATAAATTTATGCTGG - Intronic
924854981 1:247867095-247867117 TTATCTAAATAGATTAATAAAGG - Intronic
924862653 1:247941445-247941467 CCATGTAAATAAATAAATGAGGG - Intronic
1063689008 10:8265864-8265886 CTAAACAAATAGATTTATAATGG - Intergenic
1064836342 10:19535452-19535474 ATATATACATATATTTATGAGGG - Intronic
1065851031 10:29789291-29789313 CAATATAAATATATATATGATGG - Intergenic
1068206054 10:53855480-53855502 TCATGTAAATTGTTTTATGAGGG - Intronic
1068589884 10:58842680-58842702 CTATGGAAGTAGATTTAGGAGGG - Intergenic
1070322016 10:75361762-75361784 CTCTGTACCTAGATTTATGGGGG - Intergenic
1071107590 10:82116469-82116491 CTAAGTAAAAACATTTAAGATGG - Intronic
1071169216 10:82843896-82843918 CTATGTAGATAGGTTTATATTGG - Intronic
1074952827 10:118356463-118356485 TTATGTAAATAGACTTCTCAAGG + Intergenic
1077729576 11:4715597-4715619 GTATATAAAAAGATTTCTGAGGG + Intronic
1078827199 11:14940538-14940560 ATATAGAAAGAGATTTATGAGGG + Intronic
1079059431 11:17235016-17235038 ATATGTAAAAAGTTTTATGACGG - Intronic
1080344957 11:31314315-31314337 ATATATAAATAGATTTTTAAAGG - Intronic
1081029029 11:38054472-38054494 CCAGGTAGATAGATTTCTGATGG - Intergenic
1081180604 11:39981697-39981719 GTAGGTATATACATTTATGACGG + Intergenic
1081215698 11:40394599-40394621 ATGTGGAACTAGATTTATGATGG - Intronic
1081311136 11:41574276-41574298 CTATGTAAATGTATCTCTGAAGG + Intergenic
1082680233 11:56158896-56158918 ATATGTATATATATATATGATGG + Intergenic
1083500797 11:63105693-63105715 CTAGGTAAATAGGCCTATGATGG + Intronic
1084303990 11:68269942-68269964 CTATGTAAGTTGACTCATGATGG + Intronic
1085604437 11:77884590-77884612 CTATGTAAATATACTTATGAAGG + Intronic
1085654696 11:78302826-78302848 CTATACAGATAGATATATGATGG + Intronic
1087211401 11:95449095-95449117 CTATGTAAATAGTTGTTTTACGG - Intergenic
1087762519 11:102116500-102116522 ATATGTAGATGGATTAATGAAGG + Intronic
1087770892 11:102208600-102208622 CCATGTAATTATATTTTTGATGG - Intronic
1087803484 11:102530352-102530374 CTATGTAGATAGACTCAGGAAGG - Intronic
1087916225 11:103814663-103814685 CTCTGTAAATAGATTTTTCTAGG + Intergenic
1088046235 11:105455814-105455836 CTTTGTAAATAGTGTTATAAAGG + Intergenic
1088148758 11:106717426-106717448 TTAAGTAAATAGATTTATTCTGG + Intronic
1088376812 11:109150212-109150234 CTATGTATATAGATACATAAAGG + Intergenic
1091828097 12:3530254-3530276 CTATAATAATAAATTTATGAAGG + Intronic
1092076598 12:5678508-5678530 TTATGTAAAAAGATATATAAAGG + Intronic
1092188992 12:6503982-6504004 ATATGTATATATATTTGTGAGGG + Intronic
1092302805 12:7268226-7268248 ACATGTGAATAGGTTTATGAAGG - Intergenic
1092334963 12:7624119-7624141 CCATATAAATAGAATTATAAAGG - Intergenic
1093475295 12:19548050-19548072 CTATTTAAATATCTTTATGCTGG + Intronic
1094012385 12:25823049-25823071 CTCTGTAAATAATCTTATGAAGG - Intergenic
1094463193 12:30720612-30720634 CCATATAAATAGATTTAATATGG - Intronic
1095121278 12:38423087-38423109 ATATATAAATATATATATGATGG + Intergenic
1095138016 12:38629906-38629928 CTAAATAAGTACATTTATGATGG - Intergenic
1095520633 12:43060787-43060809 CTATTTAATAATATTTATGAAGG + Intergenic
1097505999 12:60471113-60471135 CTATGTAAATAGTTTGTTAAGGG - Intergenic
1097983935 12:65762992-65763014 CTTTGTAAATAGAATTTTAATGG + Intergenic
1098291582 12:68961809-68961831 TTATTTAAATAGACTTATGATGG - Intronic
1099014861 12:77331988-77332010 CTATTTAAAAAGTTTTATTATGG + Intergenic
1099526135 12:83721207-83721229 CTTGGGAAATAGATTTGTGAGGG + Intergenic
1099535813 12:83842899-83842921 ATATGTAAATACATTTAATATGG - Intergenic
1100179308 12:92067267-92067289 CTATGGAAATATATATATGGGGG - Intronic
1100469641 12:94878905-94878927 CTGTGTAAATAGATTGCAGATGG - Intergenic
1100602423 12:96123199-96123221 CTTTGTAAATTGATTTCTAAAGG - Intergenic
1100864538 12:98842895-98842917 CTATGTATGTATATTTTTGAGGG + Intronic
1103636572 12:122312181-122312203 GCATGATAATAGATTTATGATGG - Intronic
1104048489 12:125180858-125180880 CTATGCAAAGGGATTTATTAGGG - Intergenic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105966896 13:25393111-25393133 GTATGTAAATAAATTTGAGAAGG - Intronic
1107325240 13:39234936-39234958 TTATGTAAATTGATTTCTCATGG - Intergenic
1108030901 13:46228535-46228557 CCATGAAAATATATTCATGAAGG - Intronic
1108997818 13:56757547-56757569 CTAAGAAAATACATTTATTATGG + Intergenic
1109005252 13:56866782-56866804 CTATGTAGATAGATATATTTTGG + Intergenic
1109423478 13:62144141-62144163 ATAAATAAATAAATTTATGATGG - Intergenic
1109467456 13:62755671-62755693 ATATGTATATATATATATGATGG + Intergenic
1111604311 13:90518442-90518464 CTATGGACACACATTTATGAAGG + Intergenic
1112834252 13:103494274-103494296 TTATTTAAATAGAGATATGATGG - Intergenic
1112865299 13:103888834-103888856 CTATGATAATAGATTTAAGGAGG + Intergenic
1113046906 13:106166198-106166220 TTATGAAAATAGACTTATCATGG + Intergenic
1113327552 13:109296546-109296568 TTATGAAAATATATTTGTGAGGG + Intergenic
1113710832 13:112464217-112464239 CTATGTAATTATTTTTATCAGGG - Intergenic
1114144555 14:19959081-19959103 CTCTGTCAATAGAATTATAATGG + Intergenic
1115707241 14:36011892-36011914 CTATCTATATATATATATGATGG - Intergenic
1115819853 14:37202276-37202298 TTATGCAGATAGATTTAAGAGGG + Intronic
1116106984 14:40521430-40521452 CTAAACAAATAGATTTATAATGG + Intergenic
1116826789 14:49680718-49680740 CTGTGTACATTGATTTAAGATGG - Intronic
1118031438 14:61821972-61821994 CTATAAAAATGGATTTATTAGGG + Intergenic
1118083052 14:62383900-62383922 CTTTGTAAATAGCTTTATTGAGG + Intergenic
1119987851 14:79159923-79159945 ATATGTAGATGGATATATGAGGG - Intronic
1120085738 14:80270619-80270641 TTATGTAAATAAATGTATAATGG + Intronic
1120556247 14:85932379-85932401 CTTGGGAAATAGATTTGTGAGGG - Intergenic
1120649933 14:87119751-87119773 CCAAATAAATACATTTATGATGG + Intergenic
1120854144 14:89198226-89198248 CTATGTAAATAGTTGTTAGATGG - Intronic
1121714588 14:96064458-96064480 GTATGTATATATATATATGATGG + Intronic
1121760080 14:96437319-96437341 ATAAGTATATAGATTTATGGGGG - Intronic
1124131780 15:26996180-26996202 CTATGTAATTATCTTTATTAGGG + Intronic
1127080174 15:55370095-55370117 ATATGTATTTAGATTTCTGATGG - Intronic
1127753107 15:62065350-62065372 CTATGTAAATCCATAAATGATGG - Intergenic
1127972786 15:63974782-63974804 ATATGTCAAAAGATTTATTAGGG + Intronic
1128601983 15:69002814-69002836 CGAAGTAAATACATTTATGATGG - Intronic
1129576228 15:76749000-76749022 CTTTGTAAAGTGATTTAGGAAGG - Intronic
1130317256 15:82807404-82807426 ATATGTATATATATGTATGATGG - Intergenic
1131088022 15:89594271-89594293 CTAAGAAAATATATTTTTGAAGG + Intronic
1131757597 15:95582427-95582449 CTATGTAAATTGCATTATGCAGG - Intergenic
1131978071 15:97965517-97965539 CAATGTAAATAATTTTTTGAAGG - Intronic
1132031359 15:98440851-98440873 CTTTGTAATTAGATTTTTTATGG - Intronic
1132169892 15:99639971-99639993 CTTTGTAAACACTTTTATGACGG + Intronic
1133093478 16:3424469-3424491 CTCTGTTAATAGTTTTATTAGGG + Intronic
1133112269 16:3555347-3555369 TCATGTAAATAGATTTATATAGG - Intronic
1134163214 16:11909207-11909229 CTTTGAAAGTAGAATTATGATGG + Intronic
1135158890 16:20075909-20075931 CAATGTAAATAGGATTATAAGGG - Intergenic
1137264638 16:46858865-46858887 TTATGTCAATAATTTTATGAAGG + Intergenic
1137924386 16:52526166-52526188 CTTGATGAATAGATTTATGAGGG - Intronic
1137958713 16:52859432-52859454 CTTTGTAACCATATTTATGAAGG + Intergenic
1138757100 16:59501172-59501194 GTATGTAAGAACATTTATGAGGG + Intergenic
1138803786 16:60068429-60068451 CTATGTAAATTGAATTTAGAAGG + Intergenic
1139248523 16:65472194-65472216 CTGAGAAAATAGATTTGTGAGGG - Intergenic
1140544090 16:75789661-75789683 GGATTTAAATATATTTATGAGGG + Intergenic
1149050721 17:52301262-52301284 TTCTGTAAATAAATTTATAAAGG + Intergenic
1150023234 17:61642491-61642513 ATTTATAAATAAATTTATGATGG + Intergenic
1153306423 18:3635764-3635786 CTATTTAAACATAGTTATGAGGG - Intronic
1153449357 18:5209657-5209679 ATATGTAAAGAGGTTTATTATGG + Intergenic
1153838458 18:8985139-8985161 CTATGTAAATAGTTGTAGGCCGG - Intergenic
1153938936 18:9959913-9959935 ATATGTAGATAAATATATGAGGG + Intronic
1154365772 18:13707525-13707547 CCAAGTAAGTATATTTATGATGG + Intronic
1155190596 18:23426141-23426163 ATATCTAAATGGTTTTATGATGG + Intronic
1158088271 18:53680218-53680240 AGATGTAAATGGTTTTATGATGG + Intergenic
1158763055 18:60413733-60413755 CTAAGAAAATAAATTTATGTTGG + Intergenic
1159885676 18:73902361-73902383 CAATGTAAATAGAAAAATGATGG - Intergenic
1159971382 18:74658469-74658491 CTATTTACATAGATATAGGATGG + Intronic
1162703457 19:12537280-12537302 CTATGTGATTAGGTCTATGATGG + Intronic
1164253089 19:23501364-23501386 ACATTTAAATAGATTTAAGAAGG + Intergenic
1164317850 19:24110244-24110266 ACATTTAAATAGATTTAAGAAGG - Intronic
1166665842 19:44679974-44679996 CTATGTAAAGAGAAATATTAAGG + Intronic
1168114442 19:54213762-54213784 ATATGTAAATATATATATGTTGG + Intronic
925340934 2:3135438-3135460 ATATATATATATATTTATGATGG - Intergenic
927074316 2:19562043-19562065 CTAAGTAAAAAGATTTACGTAGG + Intergenic
928429918 2:31208825-31208847 CTATGCAAATAGATAGGTGAAGG + Intronic
928498287 2:31858545-31858567 CTATGTATATAGATATATATTGG - Intergenic
930382013 2:50641996-50642018 ATATGCATATAGATATATGATGG + Intronic
930616758 2:53602004-53602026 CTCAGTGAATGGATTTATGAAGG - Intronic
931110040 2:59100649-59100671 ATATGTATATATATGTATGAAGG + Intergenic
931114206 2:59147197-59147219 TTTTGTTAATAGATATATGAGGG + Intergenic
931138733 2:59433646-59433668 ATATGTGAATAAATTAATGAAGG + Intergenic
931663275 2:64589927-64589949 CTATGCAAATACATATATGGGGG + Intronic
932099374 2:68883230-68883252 ATATGTCAATTGATTTATGTCGG + Intergenic
932363811 2:71132653-71132675 CCAAGCAAATAGATTTATAATGG + Intronic
934306138 2:91823760-91823782 CTATATACATATATATATGAAGG - Intergenic
934327118 2:92028982-92029004 CTATATACATATATATATGAAGG + Intergenic
934465499 2:94259549-94259571 CTATATACATATATATATGAAGG + Intergenic
936541800 2:113358234-113358256 CTCTGAAAATAGTTTCATGAAGG + Intergenic
936739981 2:115493308-115493330 GTATGTAAATGGAATTTTGAGGG + Intronic
938755485 2:134375364-134375386 CTAAATAAATACATTTATGTTGG + Intronic
940680792 2:156782582-156782604 CTATATATATATATATATGATGG + Intergenic
941159402 2:162019074-162019096 ACATGTAGATTGATTTATGAAGG + Intronic
941982655 2:171476211-171476233 CAATGTAAACAGATTTCTGTGGG + Intronic
942474239 2:176299271-176299293 AAATGTAAATAGATTTGTCAAGG + Intronic
943429758 2:187784502-187784524 TTATATATATATATTTATGATGG - Intergenic
943621562 2:190153662-190153684 CCATATTAATAAATTTATGATGG - Intronic
945440297 2:209870668-209870690 CAATGAAAATATATTTATGTAGG - Intronic
946790679 2:223297811-223297833 CTTGCTAAATAGATTTGTGAGGG + Intergenic
947692143 2:232148478-232148500 TTATTTAAATAAATTTATTACGG - Intronic
947954618 2:234177915-234177937 ATATGTCCATATATTTATGATGG + Intergenic
1168919439 20:1518770-1518792 CTAAGTAAACAGTCTTATGAGGG - Intergenic
1174717203 20:52772268-52772290 CTATGTAAAGGTATTTATTATGG + Intergenic
1176712458 21:10164199-10164221 CTATGTTAATATATTTAAAAAGG + Intergenic
1176960026 21:15148909-15148931 TTTTGGAAATATATTTATGAGGG - Intergenic
1176995367 21:15549192-15549214 GTGTGTATATAGATTTAAGATGG - Intergenic
1177363484 21:20103910-20103932 CTTGCAAAATAGATTTATGAGGG + Intergenic
1177912942 21:27054287-27054309 ATTTAGAAATAGATTTATGAGGG + Intergenic
1179352963 21:40630845-40630867 CAATGTAATTTGATTTTTGAGGG + Intronic
1180586642 22:16898735-16898757 CTATATACATATATATATGAAGG + Intergenic
1181887935 22:26036500-26036522 CTTTGTAAATAGCTGCATGAAGG + Intergenic
1183541261 22:38430703-38430725 CTCTGTAAATAGAGTTTTCAGGG + Intronic
1184084680 22:42253589-42253611 TTATATAAAAAGATTTATGCTGG + Intronic
1184703043 22:46190311-46190333 AGATGTAAATAGATTTCTGTAGG + Intronic
949236581 3:1816533-1816555 ATATATAAATAAATTTTTGATGG + Intergenic
951512637 3:23521099-23521121 TTATGTTTATAGATATATGAAGG - Intronic
955035334 3:55262151-55262173 CTTGTTAAATAGATTTGTGAGGG + Intergenic
955185261 3:56709166-56709188 ATATTTAAATAGATTTATTGTGG - Intergenic
955583629 3:60452157-60452179 CACTGTAAATTGATTTATGCAGG - Intronic
956740942 3:72275503-72275525 CTATGCAAAGAGATTTTTAATGG + Intergenic
957318867 3:78603694-78603716 CAATGTAAACTGAATTATGAAGG + Intronic
957600388 3:82326574-82326596 CTAGGTAACTAGTTTAATGATGG + Intergenic
958606691 3:96367048-96367070 CTTTGTACATAGAAATATGATGG - Intergenic
958780463 3:98535107-98535129 CTATGTCTATAGAATTATCAAGG + Intronic
959225466 3:103577349-103577371 ATATGTAAATAAATAAATGAAGG + Intergenic
959597224 3:108141798-108141820 GTATAAAAAGAGATTTATGAGGG + Intergenic
959640292 3:108624545-108624567 AGATGTAAAAAGATTTATAAAGG - Intronic
960133168 3:114078979-114079001 CTTTGTAAATTAACTTATGAGGG + Intronic
960285854 3:115827769-115827791 CTATGTACTGAGATGTATGATGG - Intronic
960815673 3:121669639-121669661 CTATGTAATTAGATTGCTTATGG - Intronic
964098170 3:152957817-152957839 CTGTGTAGACAGATGTATGAGGG - Intergenic
964229715 3:154451268-154451290 GTATGTATATATATATATGATGG + Intergenic
965405474 3:168263078-168263100 TACTGCAAATAGATTTATGAAGG - Intergenic
967601516 3:191395580-191395602 CTGTGTAAACAGCTTTCTGAAGG + Intronic
970089440 4:12388291-12388313 CTTGCAAAATAGATTTATGAGGG - Intergenic
971464741 4:26944819-26944841 TTATGTACATGGATTTGTGAAGG + Intronic
971533973 4:27724739-27724761 CTTTGTATATGGATTTAAGATGG + Intergenic
971580910 4:28338729-28338751 CCATGTAAATAGATTTTCCAGGG + Intergenic
972083931 4:35189575-35189597 CTCTATAAATATATTTATGTAGG - Intergenic
974157073 4:58087624-58087646 TTATATAAATAGATTTTTGATGG - Intergenic
974635394 4:64557888-64557910 ATATGCATATAGATTCATGATGG + Intergenic
974663702 4:64929973-64929995 GTATGTATATATATATATGAAGG + Intergenic
975253340 4:72205595-72205617 CTATGTATATATATTTATATGGG + Intergenic
976462699 4:85330834-85330856 CTATGTAAATCAATTTTAGAGGG - Intergenic
978285831 4:107075253-107075275 CTATGTAAAGTGATTAATAATGG + Intronic
978338833 4:107699500-107699522 CCAAGAACATAGATTTATGAGGG - Intronic
979515043 4:121598049-121598071 CTTTGTAAATACATATATGAGGG - Intergenic
979654689 4:123178661-123178683 CTATGTAGATAGGATTAAGATGG + Intronic
980135731 4:128856974-128856996 CTATTTGAATCGATTTAAGATGG + Intronic
980386496 4:132092423-132092445 CTTGAAAAATAGATTTATGAGGG - Intergenic
980406140 4:132355745-132355767 CTTACTAAATAGATTTGTGAGGG - Intergenic
980406578 4:132360818-132360840 CTATTTTAATAGATTTGAGAAGG - Intergenic
980620715 4:135299283-135299305 ATATGTAAATAAATATATGCGGG - Intergenic
981209406 4:142084804-142084826 TTATGTAAATAGATAAATTAAGG - Intronic
981626394 4:146760865-146760887 CTATATATATATATATATGATGG + Intronic
982402804 4:154986476-154986498 TTATGTATATAGATATGTGAGGG - Intergenic
982701880 4:158665871-158665893 CTATATTAAGAGCTTTATGATGG - Intergenic
982966564 4:161915814-161915836 CAATGTATATAGATTTATTCAGG + Intronic
983826751 4:172271936-172271958 ATATATATATATATTTATGATGG - Intronic
984828168 4:183946921-183946943 CTATGTAAATAGTTGTAGGCAGG - Intronic
985328926 4:188805378-188805400 CTATGTGAATGGATTTAGAAAGG - Intergenic
985887885 5:2694330-2694352 GGGTGTAAATATATTTATGACGG - Intergenic
986867127 5:12002536-12002558 ATATTTAAATACATTTATTATGG - Intergenic
986868553 5:12018873-12018895 GTATGGAAATAGAGCTATGAGGG - Intergenic
987632225 5:20489063-20489085 ATATGAAAATAGATTTTTGAGGG - Intronic
987973887 5:24986613-24986635 ATATGTAAATATATATATGTAGG + Intergenic
988024880 5:25672555-25672577 CTATTTATATAGAATTAAGAAGG - Intergenic
989045565 5:37270180-37270202 CTTGCTAAATAGATTTCTGAGGG - Intergenic
989295310 5:39818702-39818724 ACATGTAAATAGATTTATCTTGG - Intergenic
989314838 5:40066587-40066609 CTATGAAAATATATTTTAGATGG + Intergenic
989438192 5:41438941-41438963 CTATAAAAATACATTTATCAAGG + Intronic
989486631 5:41998323-41998345 CTTTTGAAATAGATTTGTGAGGG - Intergenic
989740967 5:44771442-44771464 GTTTGTACATAGAATTATGAGGG - Intergenic
990058083 5:51610900-51610922 TTATGTAAATTGTTTTATGTGGG + Intergenic
990315541 5:54579526-54579548 CTCTGTAAATAGATGGATGAAGG - Intergenic
990342296 5:54835383-54835405 CTATGGATATAGATTTAGGTAGG - Intergenic
990478969 5:56188758-56188780 CTATGTAAATTGACTTAAGCTGG - Intronic
990528471 5:56651398-56651420 ATATGGAAAGAGATTTATTATGG - Intergenic
990909449 5:60839034-60839056 ATATATATATATATTTATGATGG + Intronic
990996189 5:61734436-61734458 CTGTGTATTTAGATTTATAAAGG + Intronic
991534598 5:67653811-67653833 TTATGTAAATGGATTCATGCAGG - Intergenic
991594125 5:68285115-68285137 ATATGTAAATACACTTATAATGG - Intronic
992958488 5:81935035-81935057 CTATGGTTATAGATTTCTGAGGG + Intergenic
993080667 5:83295122-83295144 GTATATAAAAAGATTTAAGAAGG - Intronic
993164593 5:84335997-84336019 ATCTTTAAATACATTTATGAGGG + Intronic
993379237 5:87186999-87187021 CTATGTAACTACATGGATGATGG - Intergenic
993464440 5:88227823-88227845 CTATTTAAATAGAATTCTTAGGG - Intronic
993500036 5:88655628-88655650 CTATTTAAATACCTTTAGGAGGG - Intergenic
994239425 5:97403869-97403891 CTATTGAAATTGATTTTTGAAGG + Intergenic
994704513 5:103185015-103185037 CTCTGTAAGTTAATTTATGAAGG + Intronic
994783483 5:104123519-104123541 CTTTGTAGATATATTTCTGAAGG - Intergenic
995269804 5:110207410-110207432 CTTTCAAAATAGATTTGTGAGGG - Intergenic
996376934 5:122820902-122820924 ATATGTAAATAGATATTTGGTGG - Intronic
997967257 5:138368187-138368209 CTATGTACTTAGATTTAAAATGG + Intronic
998852377 5:146363552-146363574 CTATAAAAATAGATTTAAAAAGG + Intergenic
999410433 5:151345510-151345532 CTCTGTACATAGATTCATCAAGG + Intronic
1000492651 5:161933930-161933952 CTAAGTAAATTAATTGATGAAGG + Intergenic
1001898815 5:175405250-175405272 ATATGAAAAGAGATTTATTATGG + Intergenic
1002326322 5:178409924-178409946 TAATGTAAATAAATTCATGAAGG - Intronic
1002554321 5:180023054-180023076 TTAAGTAAATAGATGTAGGATGG + Intronic
1003219413 6:4145255-4145277 GCATGTAATTAGATTTATAAGGG - Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1005078872 6:21936730-21936752 ATATGTATATGGAATTATGATGG + Intergenic
1005136892 6:22579429-22579451 CTGTGTAAAGAGATTCATGTAGG + Intergenic
1006810223 6:36815584-36815606 CTGTGTAAATAAATTTCTGTTGG + Intronic
1007796688 6:44354519-44354541 CTTTTTAAAAAGATTTATTAAGG + Intronic
1009914980 6:69983152-69983174 CTAAATAAATAGATATATTATGG - Intronic
1010040358 6:71374913-71374935 ATATATAAATATATATATGAGGG - Intergenic
1010456486 6:76062685-76062707 CTATGTAAATACACTCATGGTGG + Intronic
1010701106 6:79048408-79048430 CTTAGTAAATACATTTTTGAAGG + Intronic
1010784850 6:79988976-79988998 CTATATATATATATATATGAAGG - Intergenic
1011885460 6:92089504-92089526 CATTGTAAATAGATTTATATAGG + Intergenic
1012073295 6:94651076-94651098 CTTTATATATAAATTTATGAAGG - Intergenic
1012663699 6:101938808-101938830 TTCTCTAAATAGATTTAAGATGG - Intronic
1012835499 6:104260134-104260156 CTCTGTAAACACTTTTATGAAGG - Intergenic
1013862130 6:114648504-114648526 CTATCTAACTATATTTTTGATGG + Intergenic
1014970010 6:127802267-127802289 CTTGCAAAATAGATTTATGAGGG + Intronic
1015509148 6:134020314-134020336 TTGTGTAAATAGAGGTATGAAGG - Intronic
1015533056 6:134240383-134240405 CCATGTCAGTAGATTTATGGAGG + Intronic
1016124979 6:140388784-140388806 CTCTTTCAATATATTTATGATGG - Intergenic
1016219951 6:141655673-141655695 CTCTAGAAATAGATTTGTGAGGG + Intergenic
1016515687 6:144891155-144891177 CTATTTGAATAGATTTGTAATGG - Intergenic
1017374424 6:153751539-153751561 CTATTTCAATAGGTTTTTGAGGG + Intergenic
1022091710 7:27111860-27111882 CTATGTAATTTGATGTATGGGGG + Intronic
1022674189 7:32482972-32482994 ATATGTATATAGATATATAAGGG - Intergenic
1023910199 7:44549378-44549400 CTATGTAAATACCTTTATTGAGG - Intergenic
1024173704 7:46816085-46816107 CTATGTAAATAAAGTTTTAATGG + Intergenic
1028003812 7:85536466-85536488 CAATGTAAATAAATTTCTGGGGG + Intergenic
1028043617 7:86089515-86089537 CTTGCTAAATAGATTTGTGAGGG + Intergenic
1028670185 7:93393122-93393144 TTATGTAAATAGATTTAGTTTGG - Intergenic
1030862514 7:114653440-114653462 CTATTGAATTAGATTGATGATGG + Intronic
1030891970 7:115009414-115009436 TTTTGTAAATAGTTTTCTGATGG + Intronic
1032742446 7:134752486-134752508 ACTTGGAAATAGATTTATGAAGG - Intronic
1033164467 7:139027706-139027728 CTATGGGAATATATTTATAATGG + Intronic
1034857112 7:154561193-154561215 CTATGTAAAAACATTTAATAAGG + Intronic
1037266826 8:17072555-17072577 CAATGTTAAAAGATGTATGATGG + Intronic
1037347754 8:17917565-17917587 CTATGTAACTAGATATATGTTGG - Intergenic
1037453238 8:19037876-19037898 ATATGTAGAGAGATTTATTATGG - Intronic
1037482601 8:19318300-19318322 CTATGTAAATATATCTATTCTGG - Intronic
1038140179 8:24836186-24836208 GCATGTAATTAGATTTATGTAGG - Intergenic
1038261128 8:25995682-25995704 ATATGTAAAAAGATGTATAAGGG + Intronic
1040447833 8:47513796-47513818 CTATGTTAATAGCTTTAAAATGG + Intronic
1040604492 8:48917343-48917365 TTATGTAAAGAGATATATGAGGG - Intergenic
1040703626 8:50098433-50098455 CTATGTAAATAGTTGTTAGATGG - Intronic
1040764943 8:50897809-50897831 CTAGGTAAATAGCTGTAAGAGGG + Intergenic
1041360232 8:57045295-57045317 ATATGAAAAAAGATTTATTAGGG + Intergenic
1041433585 8:57812455-57812477 CTATGTCATTAGATATATAAAGG - Intergenic
1043177148 8:77036076-77036098 ATATGTATATATATATATGATGG - Intergenic
1044467244 8:92521861-92521883 CTCTGTGAAATGATTTATGATGG - Intergenic
1044855460 8:96470826-96470848 ATATTTGAATAGTTTTATGATGG + Intergenic
1045596831 8:103666443-103666465 CCAAGTAAATACATTTATCATGG - Intronic
1046745338 8:117869791-117869813 GTATGTAAATATAAATATGAGGG - Intronic
1048451950 8:134541247-134541269 ATATGTAAATCCATTCATGAGGG - Intronic
1048683656 8:136876196-136876218 CTATTTGTATAAATTTATGATGG - Intergenic
1051142601 9:13993877-13993899 CTATGGGAAAAGAATTATGAGGG - Intergenic
1051751170 9:20342509-20342531 TTCTGAAAATAGAGTTATGATGG - Exonic
1051793216 9:20832425-20832447 GTAAGTATATATATTTATGAGGG + Intronic
1051796576 9:20878663-20878685 ACATGTATATAGATATATGAGGG + Intronic
1052458644 9:28733805-28733827 ATATGTGAATGGATTTTTGAAGG - Intergenic
1052527600 9:29638940-29638962 CTATTTAAAGAAATTTGTGAAGG - Intergenic
1052564308 9:30127857-30127879 AAATGTTAATAGTTTTATGAGGG + Intergenic
1052589744 9:30476596-30476618 CTATCTAAATAGTTTTCTGTAGG - Intergenic
1053942554 9:43267373-43267395 CTATATACATATATATATGAAGG + Intergenic
1054306811 9:63435552-63435574 CTATATACATATATATATGAAGG + Intergenic
1054405542 9:64759542-64759564 CTATATACATATATATATGAAGG + Intergenic
1054439167 9:65245031-65245053 CTATATACATATATATATGAAGG + Intergenic
1054491239 9:65776910-65776932 CTATATACATATATATATGAAGG - Intergenic
1056201421 9:84280521-84280543 CAATGCCAATAGGTTTATGATGG - Intronic
1062209312 9:135355012-135355034 CTATAAAAATATATTTATTATGG + Intergenic
1202797205 9_KI270719v1_random:133189-133211 CTATGTTAATATATTTAAAAAGG + Intergenic
1186364614 X:8878338-8878360 CTAAGAAAATAAATTTTTGAGGG - Intergenic
1186655814 X:11610637-11610659 TTTTGTAAACAGATTTATGAAGG + Intronic
1187482770 X:19673321-19673343 CTATGTAAATCTATTTAACAAGG + Intronic
1188275001 X:28189567-28189589 ATATGTAAATACATAGATGAAGG - Intergenic
1188276059 X:28202377-28202399 CAATGTGAATACATTTATGGAGG - Intergenic
1188982381 X:36738648-36738670 ATATATATATATATTTATGAGGG - Intergenic
1189103797 X:38216993-38217015 CTATGTATGTAGATTCATGGTGG + Intronic
1189606866 X:42687576-42687598 CTATTTAAATAGATTTTTCTAGG - Intergenic
1189616933 X:42793816-42793838 TTATGAAAAAAGATTTGTGAAGG - Intergenic
1192690272 X:73355114-73355136 CTATATACAGAGAATTATGATGG - Intergenic
1192968862 X:76209334-76209356 ATATATAGATAGATATATGATGG - Intergenic
1197424266 X:126275607-126275629 CTATCCAAATTGATTTATAAAGG + Intergenic
1198169785 X:134094315-134094337 CCATGAAAATATATGTATGAGGG + Intergenic
1198231894 X:134697898-134697920 GTATGTAAATAGGGTCATGATGG - Intronic
1198965439 X:142224300-142224322 GTATGTCAATAAATTCATGAAGG - Intergenic
1199168907 X:144712395-144712417 ATATGTATATATATATATGAAGG - Intergenic