ID: 919337451

View in Genome Browser
Species Human (GRCh38)
Location 1:196255498-196255520
Sequence CTCAAACACATCTAGCTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919337451 Original CRISPR CTCAAACACATCTAGCTCCA AGG (reversed) Intronic
902714796 1:18265344-18265366 CTGGGACACATCTGGCTCCAAGG + Intronic
903523188 1:23970693-23970715 CTCAGACACATTTAGGTTCAGGG - Exonic
906952453 1:50345789-50345811 CACAAACACATCTAACTGTAAGG + Intergenic
908325387 1:63018409-63018431 CTGAAACACATCTGGCCCCAAGG - Intergenic
912828076 1:112924265-112924287 CTCCACAACATCTGGCTCCAGGG - Intronic
913136508 1:115895069-115895091 CTGCTACACATCTAGCTACATGG - Intergenic
916989778 1:170230345-170230367 CTCAAACATTTCTTTCTCCATGG + Intergenic
918079754 1:181196847-181196869 CTGAAATGCATCTGGCTCCAAGG + Intergenic
918548643 1:185714091-185714113 CTCAAAGTCATCTGACTCCAGGG + Intergenic
919337451 1:196255498-196255520 CTCAAACACATCTAGCTCCAAGG - Intronic
920030373 1:203034166-203034188 CTCAAACACCACTTCCTCCATGG - Intronic
920164643 1:204027043-204027065 CTGAAACACATCTAGCCCTAAGG - Intergenic
922341100 1:224655781-224655803 CCCAAACACATCTCTCTCAACGG + Intronic
922414670 1:225410245-225410267 CTCAAAGCCATCTGACTCCAAGG + Intronic
1064377546 10:14810513-14810535 TCCAAGAACATCTAGCTCCAAGG + Intergenic
1066779268 10:38926288-38926310 CTCAAACGCATAGAGCTCAAAGG + Intergenic
1067536155 10:47111718-47111740 CATAAACAGCTCTAGCTCCAGGG + Intergenic
1072438651 10:95435464-95435486 CTCAAACTTATCTATCTGCAGGG + Intronic
1072791671 10:98322400-98322422 CTAAAACAAATCTAGCCCCCAGG + Intergenic
1073142541 10:101258414-101258436 CCCAAACACACCTAGCTGCAAGG + Intergenic
1074186233 10:111101644-111101666 CTCTGCCACTTCTAGCTCCATGG + Intergenic
1074508164 10:114089400-114089422 CTCAAACACTTCTCCCTCCTTGG - Intergenic
1076059995 10:127406333-127406355 CTCACACACAGCAGGCTCCAGGG + Intronic
1078313750 11:10273306-10273328 TTCAAAAACATCTAGATCCTGGG - Intronic
1081591235 11:44424715-44424737 CCCAAACACACCTTGCTCCGGGG - Intergenic
1083618978 11:64039669-64039691 CACAAACACAGCCTGCTCCATGG - Intronic
1083693383 11:64425553-64425575 CTGAAACACATCTGGCCCCAGGG + Intergenic
1087551247 11:99652864-99652886 CTGAAACACATCTGCCCCCAAGG + Intronic
1088360805 11:108987142-108987164 CTCCTACACTTCCAGCTCCAGGG - Intergenic
1090562301 11:127945590-127945612 CTCGAACACATTTTGCCCCATGG - Intergenic
1091975918 12:4825062-4825084 CTCAAACACAAGTAGCTTGAAGG - Intronic
1092630342 12:10369831-10369853 CTAAAAGACTTTTAGCTCCAAGG - Intergenic
1092687100 12:11061657-11061679 CTCAAAAAGATGCAGCTCCATGG - Exonic
1094497168 12:30995544-30995566 CTGAAACAAAGCTGGCTCCAAGG - Exonic
1095586459 12:43854962-43854984 CTGAAACACATCTGGCCTCAAGG - Intronic
1097394249 12:59054457-59054479 CTCAAACAAATTAAGCCCCAAGG - Intergenic
1098307039 12:69112776-69112798 CTTAAACATAGATAGCTCCATGG + Intergenic
1099049989 12:77770382-77770404 CTCAATGACATCCATCTCCAAGG - Intergenic
1100470235 12:94885481-94885503 ATCAAACATATCTAGGTACATGG - Intergenic
1101399601 12:104376052-104376074 CTCAAACACATCAGGTCCCAAGG + Intergenic
1101736477 12:107466972-107466994 CTGAAACACCTCTGGCCCCAAGG + Intronic
1103092781 12:118109266-118109288 CTCAAACACTTCTCTGTCCAGGG + Intronic
1106085255 13:26535932-26535954 CTCAAACACATCTGTCCACATGG - Intergenic
1107691717 13:42960172-42960194 CTCAAACATATGTAGATCGAAGG + Intronic
1109601821 13:64641245-64641267 TTCAACCACATATAGCTCCCTGG + Intergenic
1111331569 13:86765335-86765357 CACAAACACATCCAACACCAGGG - Intergenic
1111579855 13:90208494-90208516 CTAAAACACATCTAAAGCCAAGG + Intergenic
1116066822 14:39995046-39995068 CTCAAACCCATATAACTACATGG - Intergenic
1117625324 14:57631111-57631133 CTCAGACACATTTAGGTTCAGGG + Intronic
1120680468 14:87475001-87475023 CTGAAACACAACTGCCTCCAAGG - Intergenic
1121049354 14:90810292-90810314 CTGAAATACATCTGGCCCCAAGG + Intronic
1123827328 15:24095347-24095369 GTTAAACACAGTTAGCTCCAGGG + Intergenic
1123851866 15:24365848-24365870 GTTAAACACAGTTAGCTCCAGGG + Intergenic
1125293160 15:38172274-38172296 CTCAAACACATCAAGGTTCTTGG - Intergenic
1125897086 15:43311558-43311580 CACACAAACATCTAGCTCTATGG + Intergenic
1126877181 15:53056293-53056315 GTCAAACACATGAATCTCCAGGG - Intergenic
1127218536 15:56851366-56851388 CTCAAATTCATATAGCTACAAGG + Intronic
1127349893 15:58140844-58140866 CTCAAACTAATCTAACACCATGG + Intronic
1128537476 15:68501763-68501785 CTCCACCTCATCTACCTCCATGG + Intergenic
1130996825 15:88908765-88908787 CTCAAACACATCTGGCCTCAGGG + Intronic
1132006869 15:98235256-98235278 TTCAAAGACATCTGGCTGCAAGG - Intergenic
1132486443 16:194554-194576 ATCAAACACATCTTGCTACTGGG + Intronic
1133907242 16:10033525-10033547 CCCAAACACATTTAGCTTGATGG - Intronic
1138663465 16:58541486-58541508 CTAAAACACATTTACCTTCATGG + Exonic
1139717412 16:68824531-68824553 CACAGCCACATCTAGCTGCAAGG + Intronic
1141388628 16:83646036-83646058 CTCCAACCCATACAGCTCCAAGG - Intronic
1142766094 17:2065153-2065175 CTCACACACGTCTTCCTCCAGGG - Exonic
1142943903 17:3408704-3408726 CTCAAAACCATGTAACTCCATGG - Intergenic
1144397108 17:14855086-14855108 TTCAACCCCATCTAGCCCCATGG - Intergenic
1144751550 17:17652316-17652338 CGCAATCACTTCTAGCTCCAGGG + Intergenic
1150500670 17:65647922-65647944 CTCAACCTCATCTTGCTTCATGG - Intronic
1150575104 17:66423800-66423822 CTTAAACACATTCGGCTCCAGGG - Intronic
1150869384 17:68888828-68888850 GGCAAACCCATCTAGCTCTATGG - Intronic
1151337215 17:73447065-73447087 CTCAGACACCTCCAGCTCCCTGG - Intronic
1154207285 18:12348026-12348048 CTCAAACTCACCCAGCACCATGG + Intronic
1155236864 18:23828954-23828976 CTGAAATACACCTGGCTCCAAGG - Intronic
1155237278 18:23833333-23833355 CACACACACATCTCGCTCCTGGG - Intronic
1156112340 18:33743781-33743803 CTCCAGCATATCAAGCTCCATGG + Exonic
1158532383 18:58275384-58275406 CTCAAACCCATCTTGTTCAAGGG + Intronic
1159121615 18:64177769-64177791 CACATACACATTTTGCTCCAGGG + Intergenic
1159755947 18:72365738-72365760 TTTAAACACACATAGCTCCAAGG - Intergenic
1159859833 18:73634656-73634678 CTCAAACACTTCTAACTATAAGG + Intergenic
1160325704 18:77945707-77945729 ATCAAATAGATCTAGCTCAAAGG + Intergenic
1162388271 19:10373879-10373901 CTCAAACAGATCAAGCTCTCCGG + Intronic
1163150901 19:15413379-15413401 CCAAAATACATCTAGCTCCAAGG + Intronic
1164170499 19:22720779-22720801 CCCAAACATGTCCAGCTCCAGGG + Intergenic
1164829899 19:31312330-31312352 CTTAAACATATATAGCCCCATGG - Intronic
1168448775 19:56446596-56446618 CTGAAACACATCTTGCTCCAAGG + Intronic
925615594 2:5741782-5741804 CTCACACAAACCTGGCTCCATGG + Intergenic
926174471 2:10577375-10577397 CTCCAACAGAGCTAACTCCAGGG + Intronic
929605512 2:43231584-43231606 CACAAACACATCTTTATCCAAGG - Intronic
930742687 2:54848014-54848036 CCCAAGCACATCTAATTCCAAGG + Intronic
932277952 2:70465492-70465514 CTCTGACACATCTGGCTCCAGGG + Intronic
933842350 2:86297881-86297903 CTCAAACACATCTAGGGAAAGGG - Intronic
936765065 2:115837276-115837298 ATCAATCACATCCACCTCCAAGG - Intronic
936979156 2:118248331-118248353 CTCACACACAACTAGCTAAATGG - Intergenic
937351689 2:121168959-121168981 CTTAAAAAAATCTAGCTTCAAGG + Intergenic
941747110 2:169098497-169098519 CTCCACCACATCTAGCTTGAAGG + Intergenic
942496708 2:176547615-176547637 CTGAAACATATCTGGCCCCAAGG - Intergenic
942512873 2:176721615-176721637 CTGATACACATATATCTCCATGG + Intergenic
942891191 2:180990905-180990927 CTGAAACACATCTGGCCCCAAGG - Intronic
945069345 2:205975393-205975415 CTCAACCACTTCTTTCTCCAAGG + Intergenic
945512886 2:210724477-210724499 CACTATGACATCTAGCTCCATGG - Intergenic
946520426 2:220458473-220458495 CTCAAACAGATCGAGATGCATGG + Intergenic
947907716 2:233777706-233777728 CTCAGAGACATCTAGGGCCAAGG - Intronic
948930600 2:241129359-241129381 CCCAAACACATCTGGCCCAAGGG - Intronic
1169111620 20:3037662-3037684 CCCAAACATTTCTAGCTCCATGG - Intronic
1169802486 20:9524630-9524652 CTGAAAACCATCTAGCACCAAGG - Intronic
1170245086 20:14212078-14212100 CTGAAACACATCTTGCTTCAAGG + Intronic
1170252512 20:14300352-14300374 GTCAAACACATCTATTTTCAAGG - Intronic
1173022248 20:39276704-39276726 CACAATCACATCTAACTTCAAGG - Intergenic
1173373704 20:42462954-42462976 CTCAAACTCTTCTATTTCCAAGG + Intronic
1175058165 20:56217013-56217035 CACAAACATATCTAGCTGCAAGG + Intergenic
1175377865 20:58541958-58541980 CAAAAATACATCCAGCTCCAAGG + Intergenic
1177954667 21:27582857-27582879 CTCCAACACTTCTAGCTCTGAGG - Intergenic
1178679031 21:34656473-34656495 GTCAAACACATATGTCTCCAAGG + Intergenic
1178759987 21:35393099-35393121 TTCCAAGACATCTAGCTCCATGG - Intronic
1180612858 22:17109018-17109040 CTCAAACACCTCTTCGTCCAGGG - Exonic
1182744545 22:32595563-32595585 GGCAAACACATCTGGCTTCATGG - Intronic
1183172128 22:36196346-36196368 CCTAAACACATCTAGATCCCAGG - Intronic
1183588514 22:38767015-38767037 CCCAAACATAGCTAGCTGCATGG + Intronic
949332264 3:2935574-2935596 CTCAAATACATCTTGTACCAGGG - Intronic
950410445 3:12832914-12832936 CCAAAGCACATCTGGCTCCAGGG + Intronic
959143781 3:102519357-102519379 CTCAAACACTTCAAGCACCCTGG - Intergenic
959564385 3:107819320-107819342 CATAATAACATCTAGCTCCAGGG + Intergenic
961096611 3:124162047-124162069 CTCAAAATCATCTGGCACCATGG - Intronic
963156090 3:142098866-142098888 TTCAAACACATCTAGATTCCAGG - Intronic
966215576 3:177498846-177498868 CACAGACTTATCTAGCTCCAAGG + Intergenic
967030357 3:185600351-185600373 CCTAAACACATCTGGCTCCCAGG - Intronic
970122322 4:12770462-12770484 CTCAAACCCAGCCAGCTCCTTGG + Intergenic
970428458 4:15966371-15966393 CTCAGCCACATCTAGCTGCAAGG + Intronic
973018486 4:45170842-45170864 CTCAAAATCATATAGCTACATGG - Intergenic
976151095 4:82092640-82092662 CTGAAATGCATCTAGCCCCAAGG - Intergenic
976410742 4:84710532-84710554 CCTAAACACATCCAGCTCGATGG + Intronic
977331773 4:95645421-95645443 CTCAAAAGCATATAGCTTCAAGG + Intergenic
981311635 4:143303460-143303482 CTGAAACACATCTTGCCCCAAGG - Intergenic
983292740 4:165826535-165826557 CTCTGAGACCTCTAGCTCCAGGG + Intergenic
984191769 4:176614131-176614153 TTGATACACATCTAGCTCCAGGG - Intergenic
984984422 4:185314103-185314125 CTCAAACTCATGTTGCTCAAGGG + Intronic
987157999 5:15110357-15110379 CTGAAAAATATCTAGCTCCTAGG - Intergenic
988211865 5:28214417-28214439 TGCAAACACATGTAGCTCCTGGG + Intergenic
990519210 5:56561839-56561861 CACAAACACACTTAACTCCATGG + Intronic
991648246 5:68823199-68823221 CAAAAACACATGTAGCTGCAGGG - Intergenic
996156769 5:120112263-120112285 CTCAAAGACAGGTAGCTTCATGG + Intergenic
996684318 5:126263826-126263848 CTCAAACCCACCTAGTTCAAGGG + Intergenic
997206025 5:132050678-132050700 CGCACACACATCTTCCTCCAGGG - Intergenic
997337436 5:133118212-133118234 CTCAGACACTTCAAGCTCCCTGG - Intergenic
998916270 5:147014999-147015021 CCCAAACACTTCTTGTTCCAAGG + Intronic
1002054434 5:176590542-176590564 CTCACACTCATCTTTCTCCAGGG + Exonic
1002137770 5:177118638-177118660 CTGAAACACATCTTGCTAGAAGG + Intergenic
1003798821 6:9638352-9638374 CACATACACATGTAGGTCCAAGG - Intronic
1004299502 6:14444381-14444403 CTAAAACACATCTGGCCTCAAGG + Intergenic
1005944499 6:30585547-30585569 CTGAAACCCAGCTACCTCCAGGG + Exonic
1007063505 6:38965170-38965192 CTGAAACATATCTGACTCCAAGG - Intronic
1007938545 6:45755216-45755238 CCCAGCCACACCTAGCTCCAGGG - Intergenic
1008092472 6:47307959-47307981 GAGAAACACATCTAGGTCCATGG - Intronic
1010679499 6:78782607-78782629 CTCAAACCCTTCTAGCTTAAAGG - Intergenic
1011014990 6:82744720-82744742 CTCAAAGTCATCTACCTCCCAGG + Intergenic
1012519621 6:100105544-100105566 GACAAACACATCAAGCTACATGG + Intergenic
1014089874 6:117391706-117391728 CTCCAGGACTTCTAGCTCCAGGG - Intronic
1014985849 6:128008073-128008095 CTCCAACATATATATCTCCAGGG + Intronic
1015110452 6:129586902-129586924 CTCAAATACCTCAAACTCCATGG + Intronic
1015561951 6:134525529-134525551 CTCAATCACATCTACCTGCAAGG + Intergenic
1016136286 6:140547867-140547889 CTCAGGAACATCTAGCTACAGGG + Intergenic
1016394316 6:143606022-143606044 CTGAAACACAACTGACTCCAAGG - Intronic
1016756921 6:147697253-147697275 CTCAAATCCATCTAGATTCATGG + Intronic
1021591720 7:22270715-22270737 CTGAAATACATCTAGTCCCAGGG - Intronic
1025224678 7:57147152-57147174 CTCATACTCATTTAGCACCATGG + Intergenic
1028801854 7:94975396-94975418 TTCAAAGACCTCTAGCTTCAAGG - Intronic
1029108780 7:98200378-98200400 TTCAAACCCATGTTGCTCCAGGG - Intronic
1032542088 7:132711645-132711667 CTCAGACACAGCTACCTGCAGGG + Intronic
1033159932 7:138986250-138986272 CTCTTAGACATCTAGCTCAATGG - Intergenic
1034162778 7:149005181-149005203 GTCAAACTCCTCTGGCTCCATGG + Exonic
1034465344 7:151224951-151224973 CTCAAAGTCCTCTAGCTCCTTGG + Exonic
1035980041 8:4360295-4360317 CCCAAATGCATCCAGCTCCATGG + Intronic
1036216953 8:6888580-6888602 CACACACTCATCTATCTCCACGG - Intergenic
1036563333 8:9916645-9916667 TTCAAACACATCTAGATGCCAGG - Intergenic
1037037997 8:14191600-14191622 CTCAAACACACCTGGCTGCAAGG + Intronic
1037696707 8:21230020-21230042 CTCAAACCCATGTAGCTACTGGG + Intergenic
1038865147 8:31431438-31431460 CTCAAGCTCATCTAGGACCATGG + Intergenic
1039165382 8:34673665-34673687 CTCAACCCCATCTATCTGCAGGG - Intergenic
1043657766 8:82692366-82692388 CTGAAACACATGTACCTTCAGGG - Intergenic
1043864168 8:85356942-85356964 CTGAAACACATGTGGCCCCAGGG - Intronic
1044754360 8:95446150-95446172 CAGAAACACATCTGGCTCCAAGG + Intergenic
1047241178 8:123089972-123089994 CTGAAACACATCTGGCCCCAAGG + Intronic
1048622118 8:136144962-136144984 ATCAAACACATGTGGCTTCATGG - Intergenic
1050183507 9:2946032-2946054 CTGAAACATATCTGGCACCAAGG + Intergenic
1052542099 9:29824785-29824807 CTCACACACATCTGGCAGCAGGG + Intergenic
1052816624 9:33107018-33107040 CTGGAACACATCTCGCTGCAGGG + Intronic
1053448244 9:38169995-38170017 CACAACCACACCTAGCTGCAAGG - Intergenic
1058155288 9:101507797-101507819 TTCCAACACATCTAGCTTTAAGG - Intronic
1059671360 9:116495496-116495518 CTCAGACACAACTGGGTCCAGGG - Intronic
1060172350 9:121472265-121472287 TTCCAACACATCTGGCCCCAGGG + Intergenic
1190065199 X:47235658-47235680 CTCAAACACATCTAACCTTAGGG + Intronic
1190118784 X:47643652-47643674 CTGAAACACATCTGGCCCCAGGG + Intronic
1198395425 X:136214479-136214501 CTCAAACACCTCTAACTCCTTGG - Intronic
1198737096 X:139798815-139798837 CTGACACACACCTATCTCCAAGG + Intronic
1199455482 X:148023180-148023202 CTCAAGCACATCTGGCCCCAAGG + Intronic