ID: 919339428

View in Genome Browser
Species Human (GRCh38)
Location 1:196284663-196284685
Sequence TATTATCTGGGTACTACAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919339428_919339434 -5 Left 919339428 1:196284663-196284685 CCTCCTGTAGTACCCAGATAATA 0: 1
1: 0
2: 0
3: 8
4: 115
Right 919339434 1:196284681-196284703 TAATATGTCTGGAAACTTTAGGG 0: 1
1: 0
2: 1
3: 25
4: 247
919339428_919339433 -6 Left 919339428 1:196284663-196284685 CCTCCTGTAGTACCCAGATAATA 0: 1
1: 0
2: 0
3: 8
4: 115
Right 919339433 1:196284680-196284702 ATAATATGTCTGGAAACTTTAGG 0: 1
1: 0
2: 2
3: 21
4: 278
919339428_919339435 3 Left 919339428 1:196284663-196284685 CCTCCTGTAGTACCCAGATAATA 0: 1
1: 0
2: 0
3: 8
4: 115
Right 919339435 1:196284689-196284711 CTGGAAACTTTAGGGATAATAGG 0: 1
1: 0
2: 0
3: 13
4: 135
919339428_919339437 5 Left 919339428 1:196284663-196284685 CCTCCTGTAGTACCCAGATAATA 0: 1
1: 0
2: 0
3: 8
4: 115
Right 919339437 1:196284691-196284713 GGAAACTTTAGGGATAATAGGGG 0: 1
1: 0
2: 2
3: 12
4: 174
919339428_919339436 4 Left 919339428 1:196284663-196284685 CCTCCTGTAGTACCCAGATAATA 0: 1
1: 0
2: 0
3: 8
4: 115
Right 919339436 1:196284690-196284712 TGGAAACTTTAGGGATAATAGGG 0: 1
1: 0
2: 2
3: 20
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919339428 Original CRISPR TATTATCTGGGTACTACAGG AGG (reversed) Intronic
901295922 1:8160852-8160874 CAATAACTGGGTACTACAGCTGG + Intergenic
902867061 1:19286551-19286573 GACTAGCTGGGGACTACAGGCGG - Intronic
908069653 1:60444176-60444198 TATTATTTGGGTTCTATATGAGG + Intergenic
908740603 1:67323424-67323446 TATTATCTTCGTAATACAGATGG - Intronic
910818280 1:91316146-91316168 TTTTATCTGGGTTCCAAAGGGGG + Exonic
912894961 1:113576512-113576534 GATTATCTGGGTACCTCAGTTGG + Intronic
914492614 1:148161652-148161674 TATTGACTGGGTGGTACAGGAGG - Intergenic
919339428 1:196284663-196284685 TATTATCTGGGTACTACAGGAGG - Intronic
919351659 1:196463784-196463806 TATTTTTTGGGTAGTATAGGTGG - Intronic
919853173 1:201687579-201687601 AATTATCTCTGTTCTACAGGTGG + Intronic
1063917156 10:10894919-10894941 TATTACCTGGAGACTACAAGTGG - Intergenic
1064521715 10:16209788-16209810 TATTACCTGGGTATTACTGTTGG + Intergenic
1065426923 10:25615694-25615716 TATTGTCTGGGAGCTAGAGGCGG + Intergenic
1066639770 10:37544119-37544141 TTTTATTTAGCTACTACAGGTGG - Intergenic
1072048333 10:91679362-91679384 TATTATCTGCAGACTCCAGGGGG + Intergenic
1082627871 11:55505693-55505715 TATTATCATGGTACTACACTAGG + Intergenic
1086538798 11:87883103-87883125 TTTTCTCTGGTTACTGCAGGAGG + Intergenic
1086577028 11:88350098-88350120 TATTATCTTGGTTTTACAGATGG - Intergenic
1087692571 11:101338689-101338711 GGTTATCACGGTACTACAGGAGG + Intergenic
1088412975 11:109555947-109555969 AATAATCTGGGGATTACAGGTGG + Intergenic
1088413003 11:109556238-109556260 AATAATCTGGGGATTACAGGTGG + Intergenic
1089915959 11:122156562-122156584 TTTTATCTGGGAAGGACAGGAGG + Intergenic
1094523180 12:31214699-31214721 TATTATCAGGGTTCTCCAGAAGG + Intergenic
1096665559 12:53161701-53161723 TATAATCTCGGCACTTCAGGAGG + Intronic
1098380653 12:69865984-69866006 TATTATCTGTGTTTTACAGATGG + Intronic
1098380698 12:69866548-69866570 TTTTGCCTGGGTACTAGAGGTGG + Intronic
1101267441 12:103103975-103103997 TATTATGTGGCTACTATATGTGG + Intergenic
1107177204 13:37412691-37412713 TATTATCTGGGATCTCCATGGGG - Intergenic
1117107154 14:52409625-52409647 CAGTCTCTGGGTATTACAGGAGG + Intergenic
1117605806 14:57427647-57427669 TATAAACTGGGGACTACTGGTGG + Intergenic
1120247183 14:82021288-82021310 TGTTATATGGGAACTACAGTGGG + Intergenic
1121505293 14:94472573-94472595 TATTATGCAGGTACTATAGGAGG + Intronic
1121628007 14:95400757-95400779 GAGTAGCTGGGAACTACAGGCGG - Intergenic
1122293135 14:100690183-100690205 TTTTATCTGTGTCCTACAGGAGG + Intergenic
1122332255 14:100929515-100929537 TATTCTGTTGGTAATACAGGCGG + Intergenic
1125124944 15:36209117-36209139 TTTTTTCTGGGTAGCACAGGAGG - Intergenic
1131898950 15:97066812-97066834 TTTTATCTGGGCACTAGATGTGG - Intergenic
1135323284 16:21510930-21510952 GAGTATCTGGGTAAGACAGGAGG - Intergenic
1136334771 16:29604117-29604139 GAGTATCTGGGTAAGACAGGAGG - Intergenic
1140035632 16:71369319-71369341 TCTAATCTGGGTACGACAGAGGG + Intronic
1141993472 16:87622962-87622984 TACTACCTGGGTCCCACAGGGGG + Intronic
1142035485 16:87859963-87859985 GAGTATCTGGGTAAGACAGGAGG - Intronic
1145260893 17:21353993-21354015 TATAATCTCAGTACTTCAGGAGG - Intergenic
1145828629 17:27897201-27897223 TATTAGCTGGGATCTAAAGGAGG - Intergenic
1145873156 17:28293369-28293391 AATTATGTGGGTGCTACAGAAGG + Intergenic
1146195105 17:30805237-30805259 AATAATCTAGGTACTACAGTGGG + Intronic
1150531779 17:65991000-65991022 TATTATCTGGGTATTGCTGTTGG - Intronic
1151172713 17:72261042-72261064 TCTTTCATGGGTACTACAGGGGG - Intergenic
1153688664 18:7568865-7568887 TATTACCTGGGTGACACAGGTGG + Intronic
1159727329 18:71977869-71977891 TATTACCTGGTCAATACAGGTGG + Intergenic
1159796459 18:72850152-72850174 TATTATCTGGCTACTATACATGG + Intronic
1161310479 19:3591220-3591242 TCTTATCTGGGTTCTAGAGCTGG - Exonic
926487540 2:13480813-13480835 TGCTATCTGGGTACTAGAGAAGG - Intergenic
929332832 2:40704689-40704711 TATTATGTGGGTCATACATGAGG + Intergenic
929519175 2:42632215-42632237 AAGTAGCTGGGTTCTACAGGCGG + Intronic
930309537 2:49721684-49721706 TATTATCTGGGTAATTCAGTTGG + Intergenic
937885834 2:126899506-126899528 TTTTATCTGGGTAGAGCAGGAGG - Exonic
943762564 2:191625781-191625803 AATTAACTGTGCACTACAGGGGG - Intergenic
947001168 2:225458197-225458219 TGTACTCTGCGTACTACAGGTGG + Intronic
947963670 2:234260692-234260714 GATTCACTGGGTCCTACAGGAGG - Intergenic
1170008674 20:11697014-11697036 TATTATCTGGGAACAAGAGTAGG - Intergenic
1185308762 22:50140842-50140864 TATAATCTGAGCACTTCAGGAGG - Intronic
949780951 3:7687551-7687573 TATTATATGAGTACAATAGGAGG - Intronic
954799163 3:53177244-53177266 CATAATCTTGGTACTTCAGGAGG - Intronic
957175769 3:76806719-76806741 TATTATTTCAGTACTAGAGGTGG - Intronic
957376233 3:79362478-79362500 TATTATTTAGGTTCTACAGTGGG - Intronic
960266878 3:115630307-115630329 TATTATGTGGATACTTCAGACGG - Intronic
963344990 3:144084895-144084917 TATAATCTGGGGACAACAAGAGG - Intergenic
963853132 3:150227347-150227369 TATTGTCTGGGTTTTACAGATGG - Intergenic
965499219 3:169437626-169437648 TATTTGCTGGGTGTTACAGGTGG - Intronic
973763221 4:54139786-54139808 TATTACCTGGGTATTGCTGGTGG - Intronic
974400962 4:61405580-61405602 TTTTATCTGAGGACTACAGGGGG - Intronic
976997234 4:91450053-91450075 TATGAACTGGGTACTACACAGGG + Intronic
978567788 4:110102776-110102798 CACTGTCTGGGTACTAAAGGTGG - Intronic
979677795 4:123428902-123428924 TATTATCCCAGTACTTCAGGAGG + Intergenic
984569802 4:181378325-181378347 TATTATCTGCATTTTACAGGTGG + Intergenic
986070821 5:4280643-4280665 TCTTATCTGGGGAGAACAGGAGG - Intergenic
989509681 5:42270892-42270914 TATTCACTAGGTTCTACAGGTGG - Intergenic
991205239 5:64042258-64042280 TATTACCTGGGTATTACTGCTGG - Intergenic
997158639 5:131584099-131584121 TATTATCTTTGTAATACTGGTGG + Intronic
997844371 5:137273109-137273131 TATTATCTGTGTTTTACTGGTGG - Intronic
998372677 5:141671584-141671606 TATGATCTGGGTACTGAGGGTGG + Exonic
1006654678 6:35580664-35580686 GAGTAGCTGGGGACTACAGGTGG + Intronic
1007436703 6:41818139-41818161 TATTAGCTTTGTACCACAGGTGG - Intronic
1008215252 6:48779971-48779993 AATTTTCTGGATACTACAGGTGG - Intergenic
1010066479 6:71687534-71687556 TAGTATCTGTGTTTTACAGGTGG - Intergenic
1010942768 6:81938528-81938550 TATTATCTTTGTTTTACAGGTGG + Intergenic
1012221400 6:96653354-96653376 TCTTCTCTGGGTACTGCAGTTGG - Intergenic
1021703822 7:23347146-23347168 ATTTATCTGGGTAATGCAGGCGG - Intronic
1023357959 7:39386378-39386400 TATTGTCTGGGTTCTAAAGGAGG - Intronic
1023792904 7:43768024-43768046 TATTATTGGGGGACTACAAGTGG - Intronic
1023931662 7:44709847-44709869 TATAATCTCAGTACTATAGGAGG + Intergenic
1024661290 7:51497608-51497630 TAGTATCTGGGTACTGCTGCTGG + Intergenic
1026031731 7:66800259-66800281 TATTATCAGGGTTATAAAGGAGG + Intronic
1027611487 7:80367221-80367243 TATAATCTGGGCACTTCAAGAGG + Intergenic
1027709029 7:81573811-81573833 TATAATCTGGTTGCTCCAGGAGG - Intergenic
1030788173 7:113688299-113688321 TTTTAGCTGAGTACTAAAGGAGG + Intergenic
1030920304 7:115376331-115376353 TATTATCCTGGTTATACAGGTGG - Intergenic
1032276772 7:130464007-130464029 CTTTATCAGGGTACTGCAGGAGG - Intergenic
1034713057 7:153213308-153213330 AATTATATGAGGACTACAGGAGG - Intergenic
1036713525 8:11099191-11099213 TCTTAGCTGGGTACAGCAGGAGG + Intronic
1037606678 8:20443791-20443813 TATTATCAAGATACTAGAGGTGG + Intergenic
1041466800 8:58165537-58165559 TAAGATCTGGGCACTAAAGGTGG - Intronic
1041467007 8:58167024-58167046 TAAGATCTGGGCACTAAAGGTGG - Intronic
1044906329 8:97007797-97007819 TCTTATTTGGGAACTTCAGGGGG + Intronic
1045494322 8:102695619-102695641 GATTATCTGGAGAGTACAGGTGG + Intergenic
1045944167 8:107776539-107776561 TATTATCTTTGTTTTACAGGTGG - Intergenic
1048434370 8:134402299-134402321 TATTATCAGTGTTCTACATGTGG - Intergenic
1049975259 9:855543-855565 TATTCTCTGGTGTCTACAGGTGG - Intronic
1050721960 9:8600749-8600771 TATTACCTGGGTATTACTGCTGG - Intronic
1052149529 9:25097514-25097536 TATTTTCTGGGTTCTATAGGAGG + Intergenic
1053236313 9:36457855-36457877 AATTATCAGGGGACTTCAGGAGG + Intronic
1055889812 9:81111453-81111475 TATAAACTGGGGAATACAGGTGG - Intergenic
1057048119 9:91901491-91901513 CATTATCTGCCTTCTACAGGGGG + Intronic
1058263113 9:102861456-102861478 TAATATCAGGGTATTACAGGAGG + Intergenic
1186341036 X:8646368-8646390 CTTTATCTGCCTACTACAGGTGG - Intronic
1188828429 X:34865871-34865893 TTTTTTCTGGGGACTCCAGGGGG + Intergenic
1191962395 X:66718388-66718410 TATGAGCTGGGTACTTCAGGTGG - Intergenic
1193287684 X:79732042-79732064 TATTACCTGGGTATTACTGCTGG - Intergenic
1195590703 X:106622193-106622215 TATAATCTGAGCACTTCAGGAGG - Intronic
1196304630 X:114087022-114087044 TATTATCTGGGTATTGCTGCTGG - Intergenic
1196635437 X:117996774-117996796 TATTATGTGCGTGCTACTGGTGG - Intronic
1197966341 X:132066598-132066620 AATTAACTGGGTGCTAGAGGAGG - Intergenic
1200472131 Y:3597372-3597394 TATTATCTGGGCTTTACATGGGG - Intergenic