ID: 919342002

View in Genome Browser
Species Human (GRCh38)
Location 1:196322414-196322436
Sequence AAACACAGGCTGAAACTAAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1073
Summary {0: 1, 1: 0, 2: 2, 3: 56, 4: 1014}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919342000_919342002 18 Left 919342000 1:196322373-196322395 CCAGGGAAGAATAAATATACATG 0: 1
1: 0
2: 2
3: 17
4: 272
Right 919342002 1:196322414-196322436 AAACACAGGCTGAAACTAACCGG 0: 1
1: 0
2: 2
3: 56
4: 1014

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919342002 Original CRISPR AAACACAGGCTGAAACTAAC CGG Intronic
902209963 1:14897864-14897886 AACCGCTTGCTGAAACTAACCGG + Intronic
904443038 1:30544240-30544262 AAACACATGCATAAACAAACAGG - Intergenic
904856290 1:33500400-33500422 AAACACACACTGAAAAGAACTGG - Intergenic
905022775 1:34829189-34829211 GAACACAGGCTGAAAAACACTGG + Intronic
906014202 1:42559416-42559438 ACACACAGGCTCAAAATAAAGGG + Intronic
906374808 1:45286822-45286844 ACACACAGGCTCAAAATAAAGGG + Intronic
906714680 1:47958482-47958504 ACACACAGGCTCAAAATAAAGGG + Intronic
906834813 1:49072112-49072134 ACACACAGGCTCAAAATAAAGGG - Intronic
906904863 1:49879029-49879051 ACACATAGGCTGAAAATAAAAGG - Intronic
907225731 1:52944537-52944559 AAAGACAGGCAGAAACTATTTGG - Intronic
907513307 1:54978365-54978387 GAACACAGGCTGTAACAAAGAGG + Intergenic
907969990 1:59371179-59371201 ACACATAGGCTCAAAATAACAGG + Intronic
908908239 1:69040901-69040923 ATACACAGACTGAAAATAAAGGG + Intergenic
909178502 1:72390159-72390181 ACACATAGGCTCAAAATAACGGG + Intergenic
909536123 1:76738505-76738527 ACACACAGGCTCAAAATAAAAGG - Intergenic
909720646 1:78765602-78765624 ACACACAGACTGAAAATAAAGGG - Intergenic
910514764 1:88047681-88047703 AAAGAGAGGCTGAAAGTAAGGGG - Intergenic
910801076 1:91146933-91146955 ACACACAGACTGAAAATAAAGGG - Intergenic
910805502 1:91186557-91186579 AAACATAGGCTCAAAATAAAGGG - Intergenic
910821954 1:91360318-91360340 ACACACAGGCTCAAAATAAAGGG + Intronic
910949754 1:92633541-92633563 ACACACAGGCTCAAAATAAAGGG - Intronic
911541129 1:99160102-99160124 ACACACAGGCTCAAAATAAAGGG - Intergenic
911595858 1:99798460-99798482 ACACACAGGCTCAAAATAAAGGG - Intergenic
911824088 1:102459119-102459141 ACACATAGGCTGAAACTGAAGGG - Intergenic
911981264 1:104569441-104569463 ATACACAGACTGAAAATAAATGG + Intergenic
912225990 1:107734481-107734503 ACACACAGGCTCAAAATAAAGGG + Intronic
912894640 1:113574059-113574081 ACACACAGGCTCAAAATAAATGG - Intronic
912906905 1:113717493-113717515 ACACACAGGCTGAAAATAAGGGG + Intronic
913512699 1:119576145-119576167 ACACACAGGCTCAAAATAAAGGG + Intergenic
913985488 1:143561968-143561990 ACACATAGGCTGAAAATAAAAGG - Intergenic
913990144 1:143603940-143603962 ACACATAGGCTGAAAATAAAAGG + Intergenic
914142891 1:144966763-144966785 ACACATAGGCTGAAAATAAAAGG + Intronic
914189637 1:145397857-145397879 ACACATAGGCTCAAACTAAAGGG + Intronic
914401534 1:147325656-147325678 ACACACAGGCTCAAAATAAAAGG - Intergenic
914583263 1:149038868-149038890 ACACACAGGCTCAAAATAAAGGG - Intronic
915711565 1:157904097-157904119 ACACACAGGCTCAAAATAAAGGG + Intergenic
915761509 1:158318532-158318554 ACACACAGGCTAAAAATAAAAGG - Intergenic
915817518 1:158985026-158985048 AGACACAGGCTTAAATTAAATGG - Intergenic
915844116 1:159245449-159245471 ACACACAGACTGAAAGTAAAGGG - Intergenic
915846465 1:159270819-159270841 AAACATAGGCTCAAAATAAAGGG + Intergenic
916154265 1:161828908-161828930 ACACACAGGCTCAAAATAAAGGG + Intronic
916580459 1:166102480-166102502 AAACATAGGCTCAAAATAAAGGG + Intronic
917079288 1:171239625-171239647 ACACACAGGCTCAAAATAAAGGG + Intergenic
917207694 1:172595152-172595174 ACACACAGGCTCAAAATAAAGGG - Intronic
917277244 1:173343862-173343884 AGACACTAGCTGAAGCTAACTGG + Intergenic
917370399 1:174287393-174287415 ACACACAGGCTGAAAATGAAGGG - Intronic
917594252 1:176512818-176512840 AAACACAGGCTGAAATGTAAAGG - Intronic
918160248 1:181891649-181891671 ACACACAGGCTCAAAATAAAAGG + Intergenic
918475945 1:184925274-184925296 ACACATAGGCTGAAAATAAAGGG - Intronic
918504257 1:185234479-185234501 ACACACAGGCTCAAAATAAAGGG - Intronic
918768485 1:188520496-188520518 ACACACAGGCTCAAAATAAAAGG - Intergenic
918915505 1:190631885-190631907 ACACACAGACTGAAAATAATGGG - Intergenic
919342002 1:196322414-196322436 AAACACAGGCTGAAACTAACCGG + Intronic
919411090 1:197244043-197244065 ACACACAGGCTCAAAATAAAGGG - Intergenic
919575998 1:199310655-199310677 AAAATGAGGCTGAAACTTACTGG + Intergenic
921002574 1:211058864-211058886 ACACACAGACTGAAAATAAAGGG + Intronic
921038472 1:211406161-211406183 ACACACAGGCTCAAAATAAAGGG - Intergenic
921736183 1:218631651-218631673 ATACACAGGCTCAAAATAAAGGG - Intergenic
922186611 1:223280359-223280381 ACACACAGGCTCAAAATAAAGGG + Intronic
922388312 1:225111496-225111518 ACACATAGACTGAAACTAAAAGG - Intronic
922399404 1:225237062-225237084 ACACATAGGCTGAAAATAAAGGG - Intronic
924398650 1:243652717-243652739 ACACACAGGCTCAAAATAAAGGG + Intronic
924418032 1:243879785-243879807 GAACAATGGCTGAAACTGACAGG - Intergenic
1062840573 10:667043-667065 ACACACAGGTTGTAACTAAAAGG + Intronic
1064498422 10:15940611-15940633 TAACGCAGGCTGAAACTTACAGG + Intergenic
1064789257 10:18937414-18937436 AGACACAGGCTAAAAATAAAGGG - Intergenic
1065119149 10:22512098-22512120 ACACATAGGCTGAAAATAAAGGG - Intergenic
1066139167 10:32486366-32486388 ACACACAGGCTCAAAATAAAGGG - Intronic
1066146222 10:32560941-32560963 ACACACAGGCTCAAAATAAAAGG + Intronic
1066176671 10:32914437-32914459 AAACACAGGCTCAAAATAAAGGG + Intronic
1067199034 10:44150272-44150294 ACATACAGGCTGAAAATAAAGGG - Intergenic
1067236155 10:44452091-44452113 ACACACAGGCTCAAAATAAAGGG - Intergenic
1069340736 10:67405317-67405339 ATACACAGGCTAAAAATAAAGGG + Intronic
1070631806 10:78090586-78090608 ACACATAGGCTGAAAATAAAAGG + Intergenic
1070830422 10:79414899-79414921 AAACAGAGACTGCAAGTAACTGG + Intronic
1071066518 10:81642818-81642840 ACACAGAGGCTCAAAATAACAGG - Intergenic
1071071518 10:81699175-81699197 ACACACAGGCTCAAAATAAAGGG + Intergenic
1071134331 10:82436403-82436425 ACACACAGGCTCAAAATAAAGGG - Intronic
1071441701 10:85704241-85704263 ACACACAGGCTCAAAATAAAAGG + Intronic
1071698269 10:87901698-87901720 ACACACAGGCTCAAAATAAAGGG - Intronic
1072232067 10:93422427-93422449 AAACAAAGGCTTAAACCAAGAGG + Intronic
1072405642 10:95149635-95149657 ACACACAGGCTCAAAATAAAAGG + Intergenic
1072835074 10:98702080-98702102 ACACACAGGCTCAAAATAAAGGG + Intronic
1072928997 10:99644435-99644457 ACACACAGGCTCAAAATAAAGGG - Intergenic
1073746080 10:106469446-106469468 ACACACAGGCTCAAAATAAAGGG + Intergenic
1073964310 10:108971054-108971076 AAATTCTGGCTGAAAGTAACAGG + Intergenic
1074043543 10:109816299-109816321 ACACATAGGCTCAAAATAACAGG - Intergenic
1074190848 10:111135486-111135508 ACACACAGGCTCAAAGTAAAGGG - Intergenic
1074604319 10:114945358-114945380 AAACACAGGCTTCAACTCAAAGG - Intronic
1074648277 10:115489595-115489617 ACACACAGGCTCAAAATAAAGGG - Intronic
1075500316 10:122967131-122967153 ACACACAGGCTCAAAATAAAGGG + Intronic
1076339721 10:129736430-129736452 ACACACAGGCTCAAAATAAAAGG - Intronic
1076397539 10:130151860-130151882 AAACATAGGCTCAAAATAAAGGG - Intronic
1076405491 10:130209768-130209790 CAATACAGCCTGAAACTGACAGG + Intergenic
1076580703 10:131508432-131508454 ACACATAGGCTCAAACTAAAGGG - Intergenic
1077741979 11:4856344-4856366 ACACATAGGCTGAAAATAAAGGG + Intronic
1077967224 11:7147848-7147870 AAACATAGGCTCAAAGTAAAGGG - Intergenic
1078482839 11:11693806-11693828 ACACACAGGCTCAAAATAAAGGG + Intergenic
1078807250 11:14718043-14718065 ACACATAGGCTGAAAATAAAAGG + Intronic
1078866450 11:15302422-15302444 AAGAACAGGCTGAAACTACAGGG - Intergenic
1079272037 11:18997302-18997324 AAACATAGACTGAAAATAAAAGG - Intergenic
1079482063 11:20891635-20891657 ACACACAGGCTCAAAATAAAGGG + Intronic
1079808240 11:24961616-24961638 ACACACAGGCTCAAAATAAAAGG - Intronic
1079895686 11:26115768-26115790 AAACATAGGCTCAAAATAAAAGG + Intergenic
1079935017 11:26606637-26606659 ACACACAGGCTCAAAATAAAGGG - Intronic
1080033359 11:27686265-27686287 ACACATAGGCTGAAAATAAAGGG - Intronic
1080200589 11:29664922-29664944 ACACACAGGCTCAAAATAAAGGG + Intergenic
1080507734 11:32933820-32933842 AATCACAGGCAGAATCTAAAAGG - Exonic
1080709001 11:34727862-34727884 CAACACAGGCTGAAAGCAAGTGG + Intergenic
1080917602 11:36675665-36675687 ACACATAGGCTTAAACTAAAGGG + Intergenic
1081181070 11:39986313-39986335 AGACAAAGGCTGAAAATAAAGGG + Intergenic
1081212305 11:40351885-40351907 ACACATAGGCTGAAAATAAAGGG - Intronic
1081276565 11:41156864-41156886 AAACTCATGCTGAAACTACCAGG + Intronic
1081324153 11:41725666-41725688 AAACATAGGCTCAAAATAAAGGG - Intergenic
1081958667 11:47117003-47117025 ACACATAGGCTGAAAATAAAGGG - Intronic
1082134447 11:48531777-48531799 ACACACAGGCTCAAAATAAAGGG - Intergenic
1082135588 11:48545773-48545795 ACACACAGGCTCAAAATAAAGGG - Intergenic
1082253480 11:50007215-50007237 ACACACAGGCTCAAAATAAAGGG + Intergenic
1082314182 11:50696703-50696725 ACACATAGGCTCAAAATAACAGG + Intergenic
1082314999 11:50707154-50707176 ACACATAGGCTCAAAATAACAGG - Intergenic
1082670935 11:56035387-56035409 ATACATAGGCTCAAAATAACGGG + Intergenic
1083008400 11:59370383-59370405 ACACACAGGCTCAAAATAAAGGG + Intergenic
1083008807 11:59374314-59374336 ACACATAGGCTGAAAATAAAGGG + Intergenic
1083094427 11:60234936-60234958 AAACACAGGCTGAAAGTGAAGGG + Intronic
1083345462 11:61987200-61987222 ACACACAGGCTCAAAATAAAGGG + Intergenic
1083496832 11:63062604-63062626 AAACATAGGCTCAAAATAAAGGG - Intergenic
1083567309 11:63730289-63730311 AGACACAGGTTGAAAGTAAATGG + Intronic
1084487583 11:69458938-69458960 AAATACAGGTTGAAAGTAACTGG - Intergenic
1085248202 11:75121582-75121604 ACACACAGACTGAAAATAAAGGG + Intronic
1085827892 11:79866964-79866986 AAACATAGGCTCAAAATAAAGGG + Intergenic
1086292497 11:85326895-85326917 ACACACAGGCTCAAAATAAAAGG + Intronic
1086300109 11:85418800-85418822 ACACACAGGCTCAAAATAAAGGG - Intronic
1086307563 11:85498202-85498224 ACACACAGGCTCAAAATAAAGGG + Intronic
1086312060 11:85546873-85546895 ACACATAGGCTGAAAATAAAGGG - Intronic
1086422699 11:86652867-86652889 ACACACAGGCTCAAAATAAAGGG + Intronic
1086481546 11:87245720-87245742 ACACACAGGCTCAAAATAAAAGG - Intronic
1086489354 11:87343903-87343925 ACACACAGGCTCAAAATAAAAGG - Intergenic
1086612657 11:88776308-88776330 ACACACAGGCTCAAAATAAAGGG - Intronic
1086662409 11:89436365-89436387 AAACACCGGCTGGAAATCACTGG + Intronic
1086771460 11:90773010-90773032 ACACACAGGCTCAAAATAAAGGG - Intergenic
1086828481 11:91529259-91529281 ACACACAGACTGAAAATAAAGGG + Intergenic
1086923618 11:92616347-92616369 ACACACAGGCTCAAAATAAAGGG - Intronic
1087079918 11:94160594-94160616 AAACATAGGCTCAAAATAAAGGG - Intronic
1087087650 11:94236386-94236408 ACACACAGGCTCAAAATAAAGGG - Intergenic
1087089188 11:94250307-94250329 ACACACAGGCTCAAAATAAAGGG + Intergenic
1087107569 11:94425619-94425641 ACACACAGGCTCAAAGTAAAGGG + Intronic
1087485071 11:98750129-98750151 ACACATAGGCTGAAAATAAAGGG + Intergenic
1087579927 11:100038837-100038859 ATACACAGGCTCAAAATAAAGGG - Intronic
1087586315 11:100126648-100126670 ATACATAGGCTGAAAGTAAAGGG - Intronic
1087598924 11:100287880-100287902 ACACACAGGCTCAAAATAAAAGG + Intronic
1087651483 11:100873725-100873747 AAAAAGAGGCTGAAAATAATAGG - Intronic
1087718746 11:101638221-101638243 AAACATAGGCTCAAAATAAAGGG + Intronic
1087720650 11:101661698-101661720 ACACACAGACTGAAAATAAATGG - Intronic
1088173426 11:107021912-107021934 AAACATAGGGTTAAACTAGCAGG - Intergenic
1088182109 11:107124186-107124208 ACACACAGACTGAAAATAAAGGG + Intergenic
1088444106 11:109904262-109904284 ACACCCAGGCTGAAGCTAAAGGG + Intergenic
1088703612 11:112438900-112438922 ACACACAGGCTGAAAGTGAAAGG - Intergenic
1088703785 11:112441402-112441424 ATACACAGGCTTAAGATAACTGG - Intergenic
1088790994 11:113226203-113226225 ACACACAGGCTCAAAATAAAGGG + Intronic
1089639057 11:119835111-119835133 ATAGACCTGCTGAAACTAACAGG - Intergenic
1090576929 11:128115702-128115724 ACACACAGGCTCAAAATAAAGGG - Intergenic
1090579317 11:128142324-128142346 ACACACAGGCTCAAAATAAAAGG + Intergenic
1091083910 11:132701509-132701531 AAACATAGGCTGAAAGTGAAAGG - Intronic
1091213292 11:133883133-133883155 ACACACAGGCTTAAAATAAAGGG - Intergenic
1091424399 12:374442-374464 ACACACAGGCTCAAAATAAAGGG - Intronic
1091520137 12:1230926-1230948 ACACACAGGCTGAAAACAAAAGG - Intronic
1091824683 12:3503070-3503092 ACACATAGGCTCAAAATAACAGG - Intronic
1092320957 12:7473847-7473869 ACACACAGGCTCAAAATAAAAGG + Intronic
1092512606 12:9172609-9172631 AGACACAGGCTCAAAATAAAGGG + Intronic
1092839613 12:12527255-12527277 AAACACAGGCTTTCAATAACAGG + Intronic
1093179440 12:15950551-15950573 AAAATGAGGCTGAAACTTACTGG - Intronic
1093522729 12:20069051-20069073 ACACACAGGCTTAAAATAAAGGG + Intergenic
1093534662 12:20209507-20209529 AAGCAAAGGCTTAAAATAACAGG + Intergenic
1093599562 12:21004968-21004990 ACACATAGGCTCAAACTAAAGGG + Intergenic
1093601951 12:21038015-21038037 AAACACAGGCTGAAAATGAAGGG - Intronic
1093659756 12:21741976-21741998 ACACATAGGCTGAAACTGAAAGG - Intronic
1093802576 12:23391242-23391264 AAACATAGGCTCAAAATAAAGGG + Intergenic
1093804776 12:23418542-23418564 AAACATAGGCTCAAAATAAAAGG + Intergenic
1093983657 12:25502826-25502848 AGAGACAGGCTGAAAGAAACTGG + Intronic
1094380509 12:29838115-29838137 AAACACAGACTGAAAATAAAGGG - Intergenic
1094632550 12:32190373-32190395 ATACATAGGCTGAAAGTAAAGGG + Intronic
1095306114 12:40641057-40641079 ACACACAGGCTCAAAATAAAGGG - Intergenic
1095478340 12:42608920-42608942 CATCACAGGCTGAAACCCACAGG - Intergenic
1095580009 12:43786966-43786988 AAACACAGTTTGAAAATTACAGG + Exonic
1096309548 12:50508179-50508201 AAGAACAGGCTGAAACTGCCTGG + Intronic
1097146748 12:56946089-56946111 AAACATAGACTGAAAATAAAGGG - Intergenic
1097488666 12:60236919-60236941 ACACACAGGCTCAAAATAAAGGG + Intergenic
1097530658 12:60795795-60795817 ACACATAGGCTCAAACTAAAGGG - Intergenic
1097591802 12:61583484-61583506 AAAATGAGGCTGAAACCAACTGG - Intergenic
1098080136 12:66775241-66775263 AAAAACAAGCTGAAACAAAGGGG + Intronic
1098136282 12:67405810-67405832 ACACATAGGCTGAAAATAAAGGG + Intergenic
1098142636 12:67466540-67466562 ACACACAGACTGAAAATAAATGG - Intergenic
1098389664 12:69956201-69956223 AAACACATTCTGAAAATCACAGG + Intronic
1098615554 12:72518514-72518536 ACACACAGGCTCAAAATAAAAGG - Intronic
1098623806 12:72638373-72638395 AAACATAGGCTCAAAATAAAGGG - Intronic
1098697288 12:73574664-73574686 AAACATAGGCTCAAAATAAATGG + Intergenic
1098718112 12:73858190-73858212 AAACATAGGCTGAAAGTATTGGG + Intergenic
1098926502 12:76356625-76356647 AAACACAGGAAGAAATTAAAAGG - Exonic
1099286948 12:80724950-80724972 ATACACAGGCTGAAATTACAGGG + Intergenic
1099344328 12:81479295-81479317 ACACATAGGCTGAAAATAAAGGG - Intronic
1099635872 12:85210747-85210769 AAAAATAGTCTGAAACTAAAGGG - Intronic
1099731600 12:86510613-86510635 AAACATAGGCTCAAAATAAAGGG + Intronic
1099793043 12:87361516-87361538 ACACACAGGCTCAAAATAAAGGG - Intergenic
1099878669 12:88439243-88439265 AAACATAGGCTCAAAATAAAGGG + Intergenic
1100099807 12:91090066-91090088 AAACATAGGCTCAAAATAAAGGG - Intergenic
1100750654 12:97695176-97695198 ACACATAGGCTCAAACTAAAGGG - Intergenic
1100760962 12:97806482-97806504 ACACACAGGCTCAAAATAAAGGG + Intergenic
1101206366 12:102492288-102492310 ACACACAGGCTCAAAATAAAGGG - Intergenic
1102235988 12:111295107-111295129 AAATCCTGGCAGAAACTAACAGG + Intronic
1104256159 12:127141168-127141190 ACACACAGGCTCAAAATAAAGGG - Intergenic
1105735136 13:23260414-23260436 ATACACAGGCTCAAAATAAAGGG - Intronic
1105743838 13:23357614-23357636 AGACACAGTTTGAAACTAAAAGG + Intronic
1105880745 13:24604616-24604638 ATCCACAGGCTGAAAGTAAAGGG - Intergenic
1106094820 13:26634355-26634377 ACACACAGGCTCAAAATAAAGGG - Intronic
1106640743 13:31582359-31582381 AAACATAGGCTCAAAATAAAGGG - Intergenic
1106737774 13:32605936-32605958 ACACACAGGCTCAAAATAAAGGG - Intronic
1107215931 13:37918880-37918902 AAAATCAGGCTGAAACCTACTGG + Intergenic
1107484829 13:40815745-40815767 ATCCACAGGCTGAAAGTAAAGGG + Intergenic
1107582414 13:41805184-41805206 ATACACAGACTGAAAATAAAGGG + Intronic
1107874193 13:44775367-44775389 ACACACAGGCTCAAAATAAAGGG - Intergenic
1108032153 13:46243533-46243555 AGACACAGGCTGAAAATGAAGGG + Intronic
1108262552 13:48673491-48673513 ACACATAGGCTCAAACTAAAGGG - Intronic
1108308347 13:49161468-49161490 ACACACAGGCTCAAAATAAAGGG - Intronic
1108858665 13:54826861-54826883 ACACACAGACTGAAAATAAAGGG + Intergenic
1109092685 13:58069090-58069112 AAACATAGGCTGATACCAACTGG - Intergenic
1109328873 13:60902603-60902625 ACACACAGGCTCAAAATAAAGGG + Intergenic
1109661464 13:65466200-65466222 ACACACAGGCTCAAAATAAAGGG - Intergenic
1110510541 13:76344866-76344888 ACACACAGGCTCAAAATAAAGGG + Intergenic
1110891399 13:80703059-80703081 ACACACAGGCTCAAAATAAATGG - Intergenic
1111348589 13:86996175-86996197 ACACACAGGCTCAAAATAAAGGG + Intergenic
1111663770 13:91242719-91242741 AACCTAAGGCTGAAACTAAAAGG - Intergenic
1111752291 13:92348244-92348266 ACACACAGACTGAAAATAAAGGG + Intronic
1112618581 13:101031807-101031829 ACACACAGACTGAAAATAAAGGG - Intergenic
1112663596 13:101542926-101542948 ACACACAGGCTCAAAATAAAAGG - Intronic
1112901263 13:104360530-104360552 ACACATAGGCTGAAAATAAGGGG - Intergenic
1113488312 13:110671837-110671859 ACACACAGGCTCAAAATAAAGGG + Intronic
1114485601 14:23059638-23059660 AAAAAAAGGCTGAAACTAGGAGG - Intronic
1114681593 14:24489068-24489090 AAACATAGGCTCAAAATAAAAGG + Intergenic
1114783499 14:25567730-25567752 ACACACAGACTGAAAATAAAGGG - Intergenic
1114956858 14:27831957-27831979 AAACACACACACAAACTAACAGG - Intergenic
1114983146 14:28190576-28190598 ACACATAGGCTGAAAATAAAAGG + Intergenic
1115134131 14:30088912-30088934 ACACATAGACTGAAAATAACGGG + Intronic
1116112978 14:40610541-40610563 AAACATAGGCTCAAAATAAAGGG - Intergenic
1116306579 14:43264199-43264221 AAACATAGGCTCAAAATAAAAGG + Intergenic
1116377144 14:44217464-44217486 ACACATAGGCTGAAAATAAAGGG + Intergenic
1116482982 14:45413655-45413677 ACACACAGGCTCAAAATAAATGG + Intergenic
1116560694 14:46375460-46375482 ACACACAGGCTCAAAATAAAGGG - Intergenic
1116715011 14:48415995-48416017 ACACACAGGCTCAAAATAAAGGG - Intergenic
1116744098 14:48794740-48794762 ATACACAGGCTCAAAATAAATGG + Intergenic
1116834801 14:49759693-49759715 ACACACAGTCTGAAAATAAAGGG - Intergenic
1116874631 14:50098768-50098790 AAACACAGGTTGAAAATATTCGG - Intergenic
1117086887 14:52210401-52210423 AAACATAGGCTCAAAATAAAGGG + Intergenic
1117489386 14:56230873-56230895 ACACAGAGGCTGAAAATAAAGGG + Intronic
1117510383 14:56445693-56445715 ACACATAGGCTGAAAATAAAAGG - Intergenic
1117597816 14:57341958-57341980 ACACACAGGCTCAAAATAAAAGG - Intergenic
1117629790 14:57678642-57678664 ACACACAGGCTCAAAATAAAGGG + Intronic
1117634543 14:57728248-57728270 ACACACAGACTGAAAATAAAGGG - Intronic
1117635841 14:57742346-57742368 AAACATAGGCTCAAAATAAAGGG + Intronic
1117930309 14:60835119-60835141 ACACACAGGCTCAAAATAAAGGG - Intronic
1118448587 14:65875551-65875573 CAACACAGGCTAAAAATAAAGGG - Intergenic
1120069888 14:80090788-80090810 ACACACAGGCTCAAAATAAAAGG + Intergenic
1121130620 14:91442803-91442825 ACACACAGACTGAAAATAAAGGG + Intergenic
1122158151 14:99763516-99763538 AAAGACAGGCTGAAGCTCACAGG + Intronic
1123397394 15:19950470-19950492 ACACACAGGCTCAAAATAAAGGG + Intergenic
1123496035 15:20827947-20827969 ACACACAGGCTCAAAATAAAGGG + Intergenic
1123552521 15:21397040-21397062 ACACACAGGCTCAAAATAAAGGG + Intergenic
1123588766 15:21834436-21834458 ACACACAGGCTCAAAATAAAGGG + Intergenic
1124050121 15:26189415-26189437 AAACACAGGAAGAAACGAAGAGG - Intergenic
1124053485 15:26220715-26220737 AAACATAGGCTGAAAGTGTCTGG + Intergenic
1124143588 15:27099435-27099457 GAACACAGGCACAAACAAACAGG - Intronic
1124418885 15:29499875-29499897 AAAAACAGGTTGAAAGTAAAAGG + Intronic
1125058368 15:35389710-35389732 ACACACAGGCTCAAAATAAAGGG - Intronic
1125427108 15:39559970-39559992 AAACATAGGGAGAAACTAAAAGG - Intergenic
1125823426 15:42654361-42654383 AGACACAGGTTGAAAGTAAAAGG + Intronic
1126216479 15:46160483-46160505 ACACATAGGCTGAAAATAAAGGG + Intergenic
1126440848 15:48686480-48686502 ACACACAGACTGAAAATAAAGGG + Intergenic
1126476545 15:49070831-49070853 ACACATAGGCTCAAACTAAAGGG + Intergenic
1126720308 15:51571058-51571080 ACATACAGGCTGAAAATAAAGGG + Intronic
1126996257 15:54448643-54448665 ACACATAGGCTGAAAATAAAAGG - Intronic
1127179654 15:56401254-56401276 ACACACAGGCTCAAAATAAAGGG + Intronic
1127339753 15:58028672-58028694 ACACACAGGCTCAAAATAAAGGG + Intronic
1127348693 15:58127867-58127889 ACACATAGGCTGAAAATAAAAGG + Intronic
1127491547 15:59469584-59469606 ACACACAGGCTCAAAATAAAGGG - Intronic
1127524815 15:59782536-59782558 ACACATAGGCTGAAAATAAAGGG - Intergenic
1127527274 15:59805607-59805629 ACACATAGGCTGAAAATAAAGGG + Intergenic
1127620785 15:60732253-60732275 AAACAGAGACTGAATCTAACAGG + Intronic
1127895517 15:63295380-63295402 AAAAACAGGCCTAAACTCACTGG - Intronic
1129132395 15:73512313-73512335 ACACACAGGCTCAAAATAAAAGG - Intronic
1129134352 15:73533309-73533331 ACACACAGGCTCAAAATAAAAGG + Intronic
1129498922 15:76017210-76017232 AAACACACGCTCAAAATAAAGGG - Intronic
1129561996 15:76579797-76579819 ACACACAGACTGAAAATAAAGGG + Intronic
1129578713 15:76782159-76782181 ACACACAGGCTCAAAATAAAGGG + Intronic
1129971627 15:79782611-79782633 ACACATAGGCTGAAAATAAAGGG + Intergenic
1130572072 15:85055679-85055701 ACACACAGGCTCAAAATAAAGGG - Intronic
1130703453 15:86209683-86209705 ACACACAGGCTCAAAATAAAGGG - Intronic
1130734132 15:86530231-86530253 ACACATAGGCTGAAAATAAAAGG + Intronic
1130811126 15:87379483-87379505 ACACACAGGCTCAAAATAAAGGG + Intergenic
1131054927 15:89369421-89369443 ATAGACAGGCTGAAAGGAACTGG + Intergenic
1131321542 15:91397948-91397970 ACACAAAGGCTGAAAGTAAAGGG - Intergenic
1131371657 15:91886976-91886998 AGACACAGGCAGAAACAAAGAGG - Intronic
1131589954 15:93738305-93738327 AAACACAGGCTGAAAATAAAGGG - Intergenic
1131591100 15:93748966-93748988 ACACATAGGCTGAAAATAAAGGG + Intergenic
1131595570 15:93794490-93794512 ACACACAGGCTCAAAATAAAGGG + Intergenic
1131918591 15:97298370-97298392 ACACATAGGCTGAAAATAAAGGG - Intergenic
1131991153 15:98093668-98093690 ACACAAAGGCTCAAAATAACAGG + Intergenic
1132139522 15:99380406-99380428 ACACACAGGCTCAAAATAAAGGG - Intronic
1132423550 15:101694677-101694699 AAACAGAGGCAGAAAATAAAAGG + Intronic
1202960869 15_KI270727v1_random:124270-124292 ACACACAGGCTCAAAATAAAGGG + Intergenic
1132992437 16:2803002-2803024 ACACACAGGCTGAAAGTGAAAGG - Intergenic
1133956706 16:10450683-10450705 ACACACAGGCTCAAAATAAAGGG - Intronic
1137907271 16:52335665-52335687 ACACACAGGCTTAAAATAAATGG + Intergenic
1138694783 16:58802921-58802943 TGACACATGCTGAAACTGACAGG - Intergenic
1138864887 16:60805367-60805389 ACACACAGACTGAAAATAAAGGG + Intergenic
1139023241 16:62779683-62779705 ACACACAGACTGAAAGCAACAGG - Intergenic
1139169426 16:64613434-64613456 ACACACAGGCTCAAACTAAAGGG - Intergenic
1140192841 16:72832953-72832975 AAGCCCAGGCTGACAGTAACCGG + Intronic
1140196473 16:72859631-72859653 AACCACAGGCTAAAACTCATTGG + Intronic
1140870306 16:79100526-79100548 AAGCACAGCCTGGAACTAACGGG - Intronic
1140983959 16:80140189-80140211 ACACACAGGCTCAAAATAAAGGG - Intergenic
1141451961 16:84110004-84110026 GGAAACAGGCTGAACCTAACAGG - Intronic
1142707451 17:1705141-1705163 AAAGACAGGCTGACAGTAACCGG - Exonic
1143706447 17:8700931-8700953 AGAGACAGGCTGAGACTCACTGG - Intergenic
1144888742 17:18481467-18481489 AATCACAGGCTGCCACAAACAGG + Intronic
1145143465 17:20462831-20462853 AATCACAGGCTGCCACAAACAGG - Intronic
1145686562 17:26674518-26674540 ACACACAGGCTCAAAATAAAAGG - Intergenic
1146417069 17:32644783-32644805 ACACACAGGCTCAAAATAAAGGG - Intronic
1146743077 17:35303426-35303448 AAACATAGGCTCAAAATAAAGGG + Intergenic
1148972487 17:51496480-51496502 AGACAGAGGCTAAAACAAACAGG - Intergenic
1149106417 17:52972854-52972876 AAAATGAGGCTGAAACTTACTGG - Intergenic
1149179269 17:53914996-53915018 ACACACAGGCTCAAAATAAAGGG + Intergenic
1149235123 17:54580769-54580791 AAACACAGACTGAAAATAAAAGG + Intergenic
1150000664 17:61436457-61436479 ACACACAGGCTGAAAGTAAAGGG - Intergenic
1151224632 17:72639550-72639572 AAAATGAGGCTGAAACTTACTGG - Intergenic
1154453438 18:14500451-14500473 ACACACAGGCTCAAAATAAAGGG + Intergenic
1155850616 18:30769541-30769563 AAAATAAGGCTGAAACTTACTGG + Intergenic
1155995048 18:32322186-32322208 AGCCACTGGCTGAAACTAAAAGG + Intronic
1156443562 18:37217037-37217059 ACACACAGGCTCAAAATAAAGGG - Intronic
1156590903 18:38487060-38487082 AAACAAAGGATGAAACTAGTAGG + Intergenic
1157039547 18:44022677-44022699 ACACACAGGCTCAAAATAAAAGG - Intergenic
1157694873 18:49714351-49714373 ACACAGAGGCTGAAAATAAAGGG - Intergenic
1158054108 18:53259079-53259101 ACACACAGGCTCAAAATAAAGGG - Intronic
1158072540 18:53490227-53490249 AAATACAGGCTGTAAGAAACTGG + Intronic
1158114273 18:53977646-53977668 AAACATAGGCTCAAAATAAAGGG - Intergenic
1158248565 18:55460428-55460450 ACAGACAGCCTCAAACTAACAGG + Intronic
1158398804 18:57102323-57102345 ACACACAGGCTCAAAATAAAGGG - Intergenic
1158469366 18:57721369-57721391 ACACACAGGCTCAAAATAAAAGG + Intronic
1158852844 18:61513368-61513390 ACACACAGGCTCAAAATAAAAGG - Intronic
1158853601 18:61519894-61519916 AAACACAGGCTCAAAATAAAGGG + Intronic
1159592122 18:70346811-70346833 ACACACAGGCTCAAAATAAACGG - Intronic
1159928233 18:74288202-74288224 GAACACAGGTTGAAGCTCACAGG - Intronic
1162666471 19:12217448-12217470 ACACACAGACTGAAAATAAAGGG - Intergenic
1162710089 19:12586478-12586500 AAACACAGCCTAAAATCAACAGG + Intronic
1163891259 19:20017339-20017361 ACAAACAGGCTGAAAGTGACAGG + Intronic
1163914342 19:20227062-20227084 ACACATAGGCTGAAAATAAAGGG - Intergenic
1164265813 19:23615664-23615686 ACACATAGGCTGAAAATAAAGGG + Intronic
1164688455 19:30188526-30188548 ACACACAGGCTCAAAATAAAGGG - Intergenic
1165334484 19:35159765-35159787 AAACAGAGGCTGTGAGTAACTGG + Intronic
1165688097 19:37839638-37839660 ACACATAGGCTGAAAATAAAAGG + Intergenic
1166074027 19:40403615-40403637 AAAGAGAGGCTGAAACTGACCGG - Intronic
1166172058 19:41035313-41035335 AAACATAGGCTCAAAATAAAGGG + Intergenic
1166179884 19:41100777-41100799 AAACATAGGCTCAAAATAAAGGG + Intergenic
1166415945 19:42595039-42595061 AAACACAGACAGAAAATAAAGGG - Intronic
925566409 2:5258898-5258920 ACACACAGGCTCAAAATAAAGGG + Intergenic
926338654 2:11885325-11885347 ACACACAGGCTCAAAATAAAGGG - Intergenic
926658978 2:15441779-15441801 AAACATAGGCTCAAAATAAAAGG + Intronic
926764439 2:16311831-16311853 AAACAAAGGCTGTAGCTAATGGG + Intergenic
927334558 2:21907189-21907211 ACACACAGGCTCAAAATAAAAGG - Intergenic
928293805 2:30063822-30063844 AAACACAGATTGAAAATAAAGGG + Intergenic
928439731 2:31282269-31282291 AAAATCAGGCTGAAACCTACTGG + Intergenic
928462858 2:31491358-31491380 ACACACAGGCTCAAAATAAAGGG + Intergenic
928477059 2:31638779-31638801 ACACATAGGCTGAAAGTAAAAGG - Intergenic
928488590 2:31757685-31757707 AGACACAGGCTCAAAATAAAGGG - Intergenic
928750893 2:34468781-34468803 ACACACAGGCTCAAAATAAAGGG + Intergenic
928799504 2:35069773-35069795 ACCCACAGGCTGAAAGTAAAGGG + Intergenic
929304627 2:40346880-40346902 AAAGTCAGACTGAAACTAAGTGG - Intronic
929370839 2:41222554-41222576 ATACACAGGCTCAAAATAAAAGG + Intergenic
929417623 2:41759837-41759859 AAAGACAGAATAAAACTAACCGG + Intergenic
929566733 2:42991610-42991632 ACACACAGGCTCAAAATAAAAGG + Intergenic
929649509 2:43664342-43664364 ACACATAGGCTGAAAATAAAAGG - Intronic
929838187 2:45427398-45427420 ACACACAGGCTCAAAATAAAGGG + Intronic
930150204 2:48051517-48051539 AAACTAAGGCTGAAACCTACTGG - Intergenic
930216773 2:48705762-48705784 ACACATAGGCTCAAACTAAAGGG - Intronic
930437380 2:51362560-51362582 AAACATAGGCTCAAAATAAAGGG - Intergenic
930839977 2:55835392-55835414 ACACATAGGCTGAAAATAAAGGG - Intergenic
931534917 2:63264248-63264270 ACACACAGACTGAAAGTAAATGG + Intronic
931843573 2:66179310-66179332 ACACACAGGCTCAAAGTAAAAGG + Intergenic
931907368 2:66857131-66857153 ACACACAGGCTCAAAATAAAGGG - Intergenic
932523211 2:72435767-72435789 AAACATAGGCTGAAAATAAATGG - Intronic
932935193 2:76094517-76094539 ACACACAGGCTCAAAATAAAAGG - Intergenic
933014682 2:77110252-77110274 AAATACTGGCTGAAACTAGTTGG + Intronic
933169465 2:79109566-79109588 ACACACAGGCTCAAAATAAAAGG - Intergenic
933186590 2:79286123-79286145 ACACACAGGCTCAAAATAAAAGG - Intronic
933412967 2:81949087-81949109 ACACACAGGCTCAAAATAAAAGG - Intergenic
934108278 2:88716507-88716529 AAACACAGGATCAAACTTCCAGG - Intronic
934480427 2:94636030-94636052 AAACACACACACAAACTAACAGG + Intergenic
934685191 2:96316090-96316112 AAACACAGCCAGAAACTAAAGGG + Intergenic
934894135 2:98098577-98098599 ACACACAGACTGAAAATGACAGG - Intronic
934961824 2:98682497-98682519 AAATGCATGCTAAAACTAACAGG + Intronic
935393278 2:102577648-102577670 ACACACAGACTGAAAATAAAGGG - Intergenic
935399663 2:102646575-102646597 ACACACAGGCTCAAAATAAAGGG + Intronic
936063093 2:109309624-109309646 ACACATAGGCTGAAAATAAAAGG + Intronic
936448046 2:112612550-112612572 ACACACAGGCTCAAAATAAAAGG - Intergenic
936810875 2:116400233-116400255 AAACACAGGCTCAAAATAAAGGG + Intergenic
936859824 2:117003391-117003413 ACACACAGGCTCAAAATAAAGGG + Intergenic
937380518 2:121372454-121372476 AATCACTGGCTGAAACAGACTGG + Intronic
937560824 2:123221907-123221929 ACACACAGACTGAAAATAAAGGG + Intergenic
937562929 2:123247005-123247027 ACACACAGGCTCAAAATAAAGGG + Intergenic
937847540 2:126598285-126598307 AAAAACAACCAGAAACTAACTGG + Intergenic
938075755 2:128334612-128334634 AAAGACAGGTTGAAAGTAAAAGG + Intergenic
938567883 2:132536937-132536959 ACACACAGGCTCAAAATAAATGG - Intronic
938854423 2:135295446-135295468 ACACACAGGCTCAAAATAAAAGG - Intronic
938961085 2:136342299-136342321 AAACCATGGCTGAAACAAACAGG + Intergenic
938991048 2:136630493-136630515 AAACAGAGGCAGAATCTAATAGG - Intergenic
939022737 2:136978654-136978676 AAACATAGGCTCAAAATAAAAGG - Intronic
939033501 2:137103654-137103676 ACACATAGGCTGAAAATAAAGGG + Intronic
939470891 2:142617979-142618001 AAACATAGGCTCAAAATAAAGGG + Intergenic
940503499 2:154524632-154524654 ACACACAGACTGAAAATAAAGGG - Intergenic
940609219 2:155968017-155968039 ACACACAGGCTCAAAATAAAAGG + Intergenic
940814252 2:158280399-158280421 ACACACAGGCTCAAAATAAAGGG + Intronic
940820836 2:158353349-158353371 ACACATAGGCTGAAAATAAAAGG + Intronic
940826727 2:158420858-158420880 AAACATAGGCTCAAAATAAAGGG + Intronic
940836217 2:158524755-158524777 ACACATAGGCTGAAAATAAAAGG + Intronic
941149014 2:161890659-161890681 ACACACAGGCTCAAAATAAAGGG - Intronic
941672248 2:168307488-168307510 AAACATAGACTGAAAATAAAGGG - Intergenic
941800505 2:169654074-169654096 AAAAAGAGGCTGAAACACACAGG - Exonic
941896277 2:170631771-170631793 ACACACAGGCTCAAAATAAAGGG + Intronic
942010591 2:171759070-171759092 AGACACAGGCTCAAAATAAAGGG - Intergenic
942118446 2:172751778-172751800 AAACACAGGCTGAATCAATGCGG + Intronic
942750464 2:179280730-179280752 ACACACAGACTGAAAATAAAGGG + Intergenic
942882255 2:180874865-180874887 AAACATAGCCTGAAAATAAATGG + Intergenic
943020218 2:182563923-182563945 ACACACAGGCTCAAAATAAAAGG - Intergenic
943286765 2:186011054-186011076 ACACACAGGCTCAAAATAAAGGG + Intergenic
943296322 2:186144633-186144655 ACACACAGGCTCAAAATAAAGGG + Intergenic
943357854 2:186880534-186880556 ACACATAGGCTGAAAATAAAAGG - Intergenic
943628500 2:190224407-190224429 ACACACAGGCTTAAAATAAAGGG + Intronic
944030649 2:195230572-195230594 AAACATAGGCTCAAAATAAAAGG + Intergenic
944043771 2:195385371-195385393 AAACTCAGGCTAAAACTAGCTGG - Intergenic
944196996 2:197064574-197064596 ACACACAGGCTCAAAATAAAGGG + Intronic
944307922 2:198198501-198198523 AAACATAGGCTCAAAATAAAGGG + Intronic
944339766 2:198582372-198582394 ACACACAGGCTCAAAATAAAGGG + Intergenic
944630043 2:201614832-201614854 ACACACAGGCTCAAAATAAAGGG + Intronic
945024059 2:205603718-205603740 ACACACAGGCTCAAAATAAAGGG - Intronic
945116561 2:206413927-206413949 ACACATAGGCTGAAAATAAAGGG - Intergenic
945347594 2:208737143-208737165 ACACACAGGCTCAAAGTAAAGGG - Intronic
945348630 2:208750361-208750383 AAACATAGGCTCAAAATAAAAGG - Intronic
945352896 2:208802908-208802930 ACACACAGGCTCAAAATAAAAGG + Intronic
945371368 2:209022426-209022448 AAACATAGGCTCAAAATAAAGGG + Intergenic
945378276 2:209106014-209106036 ACACATAGGCTGAAAATAACAGG + Intergenic
945870647 2:215222508-215222530 ACACACAGGCTCAAAATAAAGGG + Intergenic
946719274 2:222586631-222586653 ACACACAGGCTCAAAATAAAGGG + Intronic
946913244 2:224487389-224487411 ACACACAGGCTCAAAATAAAGGG + Intronic
948012326 2:234659250-234659272 AAACTCAGGTTGAAAGTAAAGGG + Intergenic
948235592 2:236387531-236387553 ACACACAGGCTGAAAATAAAAGG - Intronic
948959469 2:241321499-241321521 AAAGAGAGGCTGAAAATAAAGGG - Intronic
1169059977 20:2654073-2654095 AAACACAGGCTGAGAAAAAAAGG + Intronic
1169319758 20:4622869-4622891 ACACATAGGCTCAAACTAAAAGG - Intergenic
1169671952 20:8112757-8112779 ACACATAGGCTGAAAATAAAAGG - Intergenic
1169796046 20:9463539-9463561 ACACACAGGCTCAAAATAAAGGG + Intronic
1170082696 20:12493860-12493882 ACACACAGGCTCAAAATAAAGGG + Intergenic
1170354328 20:15475683-15475705 CAGCACATGCTGACACTAACGGG - Intronic
1170849617 20:19993286-19993308 AAGCCCAGACTGAAACTCACGGG - Intronic
1170863506 20:20130875-20130897 AAACACAGCCAGAAACAAAGTGG - Intronic
1171039705 20:21749540-21749562 ACACATAGGCTCAAAATAACAGG - Intergenic
1171065614 20:22011693-22011715 ACACATAGGCTCAAACTAAAAGG + Intergenic
1171352516 20:24514397-24514419 AAACATAGGCTCAAAGTAAAGGG + Intronic
1171808871 20:29723446-29723468 AAACATAGGCTCAAAATAAAAGG + Intergenic
1171814281 20:29769959-29769981 AAACACAGGCTCAACATAAAGGG + Intergenic
1172395330 20:34599630-34599652 AAGTTGAGGCTGAAACTAACTGG + Intronic
1172770612 20:37380292-37380314 AATCAGGGGCTGAAACTCACAGG - Intronic
1173203968 20:40977339-40977361 ACACACAGACTGAAAATAAAGGG - Intergenic
1173385245 20:42581540-42581562 AAAAAAAGGCTTAAACTCACAGG + Intronic
1173441591 20:43082112-43082134 AGACACAGGTTGAAAATAAAGGG - Intronic
1174124188 20:48290582-48290604 AAACACAGGAGGAAACCAGCGGG + Intergenic
1174752357 20:53124093-53124115 AAACACTGGCTGACGCTAAAAGG - Intronic
1174836207 20:53857703-53857725 CAACAGAGGCTGAAACAAAGAGG + Intergenic
1174953109 20:55065310-55065332 ACACACAGGCTCAAAATAAAGGG - Intergenic
1175041185 20:56052136-56052158 ACACACAGGCTCAAAATAAAGGG + Intergenic
1176316691 21:5252211-5252233 ACACACAGGCTCAAAATAAAGGG - Intergenic
1176743895 21:10633339-10633361 ACACACAGGCTCAAAATAAAGGG + Intergenic
1176820748 21:13652841-13652863 ACACACAGGCTCAAAATAAAGGG - Intergenic
1176941345 21:14929219-14929241 ACACATAGGCTGAAAATAAAAGG + Intergenic
1177216149 21:18131551-18131573 AATTACAGGATGAAAATAACTGG - Intronic
1177494408 21:21871028-21871050 ACACACAGACTGAAAATAAAGGG - Intergenic
1177810554 21:25920500-25920522 ACACACAGGCTCAAAATAAAAGG + Intronic
1177912502 21:27050147-27050169 ACACACAGGCTCAAAATAAAAGG - Intergenic
1179050966 21:37888316-37888338 AACCACAGGCTGAAGCTAATTGG + Intronic
1180323289 22:11343676-11343698 ACACACAGGCTCAAAATAAAGGG + Intergenic
1180394510 22:12318139-12318161 AAACATAGGCTCAAAATAAAGGG - Intergenic
1180405235 22:12546609-12546631 AAACATAGGCTCAAAATAAAGGG + Intergenic
1181555105 22:23665237-23665259 ACACACAGGCTCAAAATAAAGGG + Intergenic
1181861212 22:25819793-25819815 GAAAACAGGCTGATACTAAGTGG - Intronic
1183182484 22:36269795-36269817 ACACATAGGCTGAAAATAAAGGG - Intergenic
1183497467 22:38155953-38155975 ACACATAGACTGAAACTAAAGGG + Intronic
1184466431 22:44671060-44671082 AAACCCAGGCAGAAACAGACAGG + Intronic
949448249 3:4158846-4158868 ACACACAGACTGAAAATAAAGGG - Intronic
949452601 3:4203449-4203471 ACACAAAGGCTGAAAATAAAGGG - Intronic
949640817 3:6034282-6034304 ACACACAGGCTCAAAATAAAGGG - Intergenic
949800982 3:7904207-7904229 ACACATAGGCTCAAACTAAAGGG - Intergenic
950864830 3:16180814-16180836 AAACACAGGCTGAACCATAAAGG - Intronic
950946840 3:16957897-16957919 ACACACAGGCTCAAAATAAAGGG - Intronic
951028649 3:17857646-17857668 ACACATAGGCTGAAAATAAAGGG - Intronic
951398937 3:22206055-22206077 ACACACATGCTGAAAATAAAAGG + Intronic
952575127 3:34765341-34765363 ACACACAGGCTCAAAATAAAGGG + Intergenic
952607756 3:35170828-35170850 AAAAACAGGCTCAAAATAAAGGG - Intergenic
952726045 3:36585661-36585683 ACACACAGACTGAAAATAAAGGG + Intergenic
952980570 3:38731622-38731644 AAAAACAGGCTGAAATCAATTGG + Intronic
953102109 3:39840340-39840362 ACACACAGGCTCAAAATAAAGGG - Intronic
953130824 3:40136156-40136178 AAACATAGGCTCAAAATAAAGGG + Intronic
953309200 3:41860587-41860609 ACACACAGGCTGAAAATAAAGGG - Intronic
953335986 3:42094343-42094365 CAAGTCAGGCTGAAACTATCAGG + Intronic
954497741 3:50981813-50981835 AAACATAGATTGAAAGTAACGGG - Intronic
954500575 3:51010488-51010510 ACACACAGGCTCAAAATAAAGGG - Intronic
955031154 3:55220549-55220571 ACACATAGACTGAAACTAAAGGG - Intergenic
955172404 3:56580278-56580300 ACACACAGGCTCAAAATAAAGGG - Intronic
955423350 3:58762406-58762428 ACACACAGGCTCAAAATAAAAGG - Intronic
955630095 3:60964301-60964323 ACACATAGGCTCAAACTAAAGGG - Intronic
955637459 3:61045255-61045277 ACACACAGGCTCAAAATAAAGGG + Intronic
955652896 3:61213278-61213300 AAACATAGGCTCAAAATAAAGGG + Intronic
955843689 3:63138405-63138427 ACACACAGGCTCAAAATAAAAGG + Intergenic
955899349 3:63735447-63735469 ACACACAGGCTCAAAATAAAAGG + Intergenic
956477191 3:69635207-69635229 ACACACAGGCTCAAAATAAAGGG - Intergenic
956550112 3:70448886-70448908 ACACACAGGCTCAAAATAAAAGG - Intergenic
957174105 3:76782743-76782765 ATACACAGCCTGAAAGTAAGTGG - Intronic
957218189 3:77348559-77348581 AAAATAAGGCTGAAACTTACCGG - Intronic
957324722 3:78677446-78677468 ACACACAGGCTCAAAATAAAAGG + Intronic
957745554 3:84337196-84337218 ACACATAGGCTGAAAATAAAGGG - Intergenic
957776737 3:84763286-84763308 ATACACAGGCTCAAAATAAAGGG + Intergenic
957925690 3:86807712-86807734 ACACATAGACTGAAAATAACAGG + Intergenic
958067182 3:88558430-88558452 ACACACAGGCTCAAATTAAAGGG + Intergenic
958410044 3:93805256-93805278 ACACATAGGCTCAAAATAACAGG - Intergenic
958569643 3:95862646-95862668 AAACACAGGCTCAAAACAAAGGG + Intergenic
958656252 3:97007474-97007496 ACACACAGGCTCAAAATAAAGGG - Intronic
958694343 3:97509054-97509076 ACACACAGGCTCAAAGTAAAGGG - Intronic
958749340 3:98176359-98176381 ACACATAGGCTCAAACTAAAGGG + Intronic
958769449 3:98408846-98408868 ACACATAGGCTCAAACTAAAGGG + Intergenic
958861020 3:99445538-99445560 ACCCACAGGCTCAAACTAAGTGG - Intergenic
958972524 3:100628211-100628233 AAAAACAGGCAGAAACTGAAAGG - Intronic
958976757 3:100676957-100676979 ACACACAGACTGAAAATAAATGG - Intronic
958992175 3:100859600-100859622 AAACAAAGGCTGAAATAAAAGGG + Intronic
959118260 3:102203578-102203600 ACACACAGACTGAAAATAAAGGG - Intronic
959125021 3:102280724-102280746 ACACACAGGCTCAAAGTAAAGGG - Intronic
959218330 3:103482025-103482047 ACACACAGGCTCAAAATAAAGGG - Intergenic
959735212 3:109650168-109650190 ACACATAGGCTGAAAATAAAGGG + Intergenic
959883304 3:111471741-111471763 ACACACAGGCTCAAAATAAAGGG - Intronic
960012011 3:112843826-112843848 ACACACAGGCTGAAAGTAAAGGG + Intronic
960339510 3:116457452-116457474 ACACACAGGCTCAAAATAAAAGG + Intronic
960502925 3:118458981-118459003 ACACACAGGCTCAAAATAAAGGG + Intergenic
960542549 3:118877695-118877717 ACACACAGACTGAAAATAAAGGG + Intergenic
960565608 3:119128523-119128545 ACACACAGGCTCAAAATAAAGGG + Intronic
960870201 3:122240308-122240330 ACACATAGGCTGAAAATAAAGGG + Intronic
961964122 3:130884866-130884888 ACACATAGGCTGAAAATAAAAGG - Intronic
962015473 3:131434893-131434915 ACACACAGACTAAAACTAAAGGG + Intergenic
962554235 3:136530012-136530034 ACATACAGACTGAAACTAAAGGG + Intronic
962696702 3:137955539-137955561 ACACACAGGCTCAAAATAAAGGG + Intergenic
962931932 3:140046382-140046404 ACACACAGGCTCAAAATAAAGGG - Intronic
963109276 3:141672442-141672464 ACACACAGGCTCAAAATAAAGGG + Intergenic
963326456 3:143868758-143868780 AAACACTTGCTTAAACAAACAGG + Intergenic
963484618 3:145920159-145920181 ACACACAGGCTCAAAATAAAAGG + Intergenic
963532232 3:146485060-146485082 ACACACAGGCTCAAAATAAAGGG + Intronic
963592227 3:147275716-147275738 ACACACAGGCTCAAAATAAACGG + Intergenic
963776070 3:149442178-149442200 ATACACAGACTGAAAGTAGCTGG - Intergenic
963976545 3:151486075-151486097 ACACATAGGCTCAAACTAAAGGG + Intergenic
964613363 3:158636648-158636670 ACACATAGGCTGAAAATAAAAGG + Intergenic
964804314 3:160590224-160590246 ACACACAGACTGAAAATAAATGG + Intergenic
964816425 3:160721955-160721977 ACACACAGGCTCAAAGTAAAGGG + Intergenic
964842909 3:161013891-161013913 AAACATAGGCTCAAAATAAAGGG - Intronic
964954503 3:162335454-162335476 AAAAAGAGGCTCAAACTAACAGG + Intergenic
965009954 3:163074404-163074426 ACACACAGACTGAAAATAAAGGG + Intergenic
965015332 3:163150342-163150364 ACACACAGGCTCAAAATAAAAGG - Intergenic
966063252 3:175785573-175785595 ACACACAGGCTCAAAATAAAAGG - Intronic
966312716 3:178612602-178612624 AAACATAGACTGAAAATAAAAGG - Intronic
966381809 3:179352130-179352152 CAACACAGGCAGAAACTTGCGGG - Intronic
966753427 3:183344699-183344721 ACACACAGGCTCAAAATAAAGGG + Intronic
966902463 3:184496707-184496729 AAACACTGGCTGAAAATCAACGG - Intronic
967580667 3:191149682-191149704 ACACACAGGCTCAAAATAAAAGG - Intergenic
967638851 3:191836726-191836748 AAACATAGGCTCAAAATAAAGGG + Intergenic
968418235 4:459417-459439 AAACACAGGCTCAAAATAAAGGG + Intronic
968692358 4:1999418-1999440 ACACACAGGCTCAGAATAACGGG + Intronic
970655173 4:18223186-18223208 ACACACAGGCTCAAAATAAAGGG - Intergenic
970864301 4:20740843-20740865 AAACATAGGCTCAAAATAAAGGG + Intronic
971151321 4:24035129-24035151 AAACACTTGTTGAAACTAACAGG + Intergenic
971429825 4:26554379-26554401 ACACACAGGCTCAAAATAAAGGG - Intergenic
971437463 4:26642702-26642724 AAACATAGGCTCAAAATAAAGGG + Intronic
971476116 4:27074107-27074129 AAACATAGGCTCAAAATAAAAGG - Intergenic
971520965 4:27549959-27549981 AAACATAGGATGAAAATAATTGG + Intergenic
972124285 4:35743394-35743416 ACACACAGGCTTAAAATAAAAGG + Intergenic
972468672 4:39383588-39383610 GAACATAGGCTGTAACTAAGGGG - Intergenic
972834395 4:42851739-42851761 ATACACAGGCTGAAAGTGAAGGG - Intergenic
972854972 4:43095133-43095155 ACACACAGGCTCAAAATAAAAGG + Intergenic
973189261 4:47368328-47368350 AACCACAGGCTTAAACTGATAGG - Intronic
973284590 4:48401645-48401667 ACATACAGGCTGAAAATAAAGGG - Intronic
973564333 4:52169082-52169104 ACACACAGGCTCAAAATAAAGGG - Intergenic
973595392 4:52483443-52483465 AGAAACAGGCAGAAACTAAAAGG - Intergenic
973608930 4:52615308-52615330 AGACACAGGTTGAAAGTAAATGG + Intronic
973679364 4:53300221-53300243 ACACACAGGCTCAAAATAAAGGG + Intronic
973682109 4:53330868-53330890 ACACACAGGCTCAAAATAAAAGG + Intronic
973835981 4:54809360-54809382 ACACACAGGCTCAAAATAAAAGG + Intergenic
974127728 4:57716369-57716391 ACACACAGGCTCAAAATAAAGGG + Intergenic
974182258 4:58399635-58399657 ACACATAGGCTGAAAATAAAGGG - Intergenic
974253674 4:59421909-59421931 ACACACAGGCTCAAAATAAAGGG + Intergenic
974307495 4:60159544-60159566 AGACACAGGCTCAAAATAAGGGG + Intergenic
974513338 4:62874039-62874061 ACACACAGGCTGAAAATAAAGGG + Intergenic
974696794 4:65386957-65386979 AAAAAAAGGCTGAAACTTATAGG + Intronic
974768144 4:66375271-66375293 AAAGAAGGGATGAAACTAACTGG - Intergenic
975388853 4:73792716-73792738 ACACACAGGCTTAAAATAAAGGG - Intergenic
975448553 4:74497812-74497834 ATACATAGGCTGAAAGTAAAAGG - Intergenic
975505175 4:75128943-75128965 ACACATAGGCTCAAACTAAAAGG + Intergenic
975796904 4:78015726-78015748 GAAAACAGGACGAAACTAACAGG + Intergenic
975952646 4:79792501-79792523 AAACACAGGCTGAAAATAAAGGG - Intergenic
976093000 4:81476212-81476234 ACACACAGGCTCAAAATAAAGGG + Intronic
976161446 4:82203988-82204010 AGACACAGACTGAAAATAAAGGG + Intergenic
976272306 4:83243075-83243097 ACACACAGGCTCAAAATAAAGGG + Intergenic
976375047 4:84336947-84336969 AACCACAGGCTCAAAGTAAAGGG - Intergenic
976490526 4:85665383-85665405 ACACATAGGCTGAAAATAAAAGG - Intronic
976621402 4:87131502-87131524 AAACAAAGGCTTAAACTGAGAGG - Intronic
976676840 4:87712510-87712532 ACACACAGGCTCAAAATAAAAGG + Intergenic
976682384 4:87771342-87771364 AAACATAGGCTCAAAATAAAGGG + Intergenic
976794957 4:88921823-88921845 AAACATAGGCTCAAAATAAAAGG + Intronic
977108472 4:92920216-92920238 ACACACAGGCTCAAAATAAAGGG - Intronic
977110089 4:92942438-92942460 ACACACAGGCTCAAAATAAAGGG - Intronic
977342328 4:95774567-95774589 ACAAACAGGCTGAAAGTAAAAGG + Intergenic
977404603 4:96579770-96579792 ACACACAGGCTCAAAATAAAGGG - Intergenic
977511413 4:97967131-97967153 ACACACAGGCTCAAAATAAAGGG + Intronic
977524097 4:98124048-98124070 ACACACAGGCTCAAAATAAAGGG - Intronic
977829299 4:101571437-101571459 AAAATGAGGCTGAAACCAACTGG - Intronic
977872515 4:102109018-102109040 ACACACAGGCTGAAAGTGAAAGG + Intergenic
978032668 4:103954507-103954529 ACACACAGACTGAAAATAATGGG + Intergenic
978206403 4:106085217-106085239 ATACACAGGCTCAAAATAAAGGG + Intronic
978517582 4:109585317-109585339 ACACACAGGCTCAAAATAAAGGG - Intronic
978657065 4:111076811-111076833 ACACACAGGCTCAAAATAAAAGG + Intergenic
978715980 4:111842723-111842745 AAACACAAGTTGGTACTAACTGG + Intergenic
978980301 4:114937086-114937108 TAAAACAAGCTGAAACTAACAGG - Intronic
979017250 4:115450556-115450578 ACACACAGGCTCAAAATAAAGGG - Intergenic
979197614 4:117939641-117939663 ACACACAGGCTCAAAATAAAGGG - Intergenic
979326349 4:119384526-119384548 ACACACAGGCTCAAAATAAAGGG - Intergenic
979413682 4:120409409-120409431 ACACACAGACTGAAAATAAAGGG + Intergenic
979461396 4:120988559-120988581 ATACACAGGCTCAAAATAAAGGG - Intergenic
979583658 4:122389723-122389745 ACACACAGGCTCAAAATAAAGGG - Intronic
979639947 4:123002173-123002195 ACACACAGGCTCAAAATAAAAGG - Intronic
980151428 4:129053623-129053645 ACACACAGGCTCAAAATAAAGGG - Intronic
980392701 4:132167772-132167794 AAACACAGGCTCAAAATAAAGGG - Intergenic
981174283 4:141662528-141662550 AAAAACAGGCTGAAAGTAAATGG - Intronic
981297813 4:143153371-143153393 ACACACAGACTGAAAATAAAGGG - Intergenic
981326101 4:143449659-143449681 ACACACAGGCTCAAAATAAAAGG - Intronic
981741199 4:148003779-148003801 ACACACAGGCTCAAAATAAAGGG - Intronic
982071818 4:151702156-151702178 AGACACAGGCTGGAAAAAACAGG + Intronic
982511470 4:156288457-156288479 ACACATAGGCTGAAAATAAAAGG - Intergenic
983047248 4:163002587-163002609 ACACATAGGCTGAAAATAAAGGG - Intergenic
983121326 4:163888937-163888959 AGACACAGGCTTACACTCACAGG - Intronic
983131489 4:164024859-164024881 AACCACAGGCTCAAAGTAAAGGG + Intronic
983165724 4:164475098-164475120 ACACATAGACTGAAAGTAACGGG - Intergenic
983173034 4:164557365-164557387 ACACATAGGCTGAAAATAAAAGG - Intergenic
983244211 4:165269180-165269202 ACACACAGGCTCAAAATAAAGGG - Intronic
983665581 4:170177965-170177987 ACACATAGGCTGAAACTAAAGGG - Intergenic
983673648 4:170267170-170267192 ACACACAGGCTCAAAATAAAGGG - Intergenic
983683763 4:170383328-170383350 ACACATAGGCTGAAAATAAAGGG - Intergenic
983857574 4:172664346-172664368 AATCACAAGCTGAAACTTAAAGG - Intronic
984335242 4:178381251-178381273 ACACACAGGCTTAAAATAAAGGG + Intergenic
984345284 4:178514781-178514803 AAACATAGGCTCAAAATAAAGGG - Intergenic
984493897 4:180470659-180470681 AAACATAGGCTCAAAATAAAAGG + Intergenic
985029360 4:185773270-185773292 AAGCCCAGGCTCAAAATAACGGG + Intronic
986260701 5:6143589-6143611 AACCAGAAGCTGAAACTAATAGG + Intergenic
986382016 5:7195904-7195926 ACACACAGGCTCAAAATAAAAGG + Intergenic
986472270 5:8088083-8088105 ACACACAGGCTCAAAATAAAAGG - Intergenic
986478529 5:8160672-8160694 ACACACAGGCTCAAAATAAAAGG + Intergenic
986675417 5:10179910-10179932 ACACACAGGCTCAAAATAAAGGG + Intergenic
986890692 5:12301435-12301457 ATACATAGGCTGAAAGTAATGGG + Intergenic
987305752 5:16636488-16636510 ACACACAGGCTCAAAATAAAGGG - Intergenic
987643284 5:20638673-20638695 AAACACAGGGAGAAACTTTCAGG + Intergenic
988021734 5:25629503-25629525 ACACACAGGCTCAAAATAAAGGG + Intergenic
988839364 5:35068104-35068126 AAAGGCTGGCTGAAACTACCAGG + Intronic
988887274 5:35572090-35572112 AAACATAGGCTCAAAATAAAAGG - Intergenic
988892906 5:35638771-35638793 AAACACACGCTGCAACTTTCAGG - Intronic
989074578 5:37550603-37550625 ACACACAGACTGAAAATAAAGGG - Intronic
989092292 5:37745550-37745572 ACACACAGGCTCAAAATAAAGGG + Intronic
989207468 5:38825547-38825569 AAACTCGGGCAGAAACTAAGGGG + Intergenic
989542790 5:42637147-42637169 AAACACAATCTGAAACAAACAGG - Intronic
989623209 5:43404783-43404805 ACACACAGGCTCAAAATAAAGGG + Intronic
989784844 5:45314686-45314708 ACACACAGGCTCAAAATAAAGGG + Intronic
989825551 5:45850041-45850063 AAACATAGGCTCAAAATAAAGGG + Intergenic
989861968 5:46389087-46389109 ACACACAGGCTCAAAATAAAAGG - Intergenic
990060343 5:51639013-51639035 AAACATAGGCTCAAAATAAAGGG + Intergenic
990668795 5:58104011-58104033 ACACACAGGCTCAAAATAAAGGG - Intergenic
990807935 5:59687841-59687863 ACACACAGGCTCAAAATAAAGGG + Intronic
990853996 5:60242110-60242132 ACACACAGACTGAAACTAAAAGG + Intronic
990913637 5:60879734-60879756 ACACATAGGCTGAAAATAAAGGG - Intronic
991053147 5:62293797-62293819 ATACATAGGCTCAAACTAAAGGG + Intergenic
991097514 5:62754651-62754673 ACACACAGGCTCAAAATAAAGGG + Intergenic
992584677 5:78224631-78224653 ATAAACAGGCTGAAAGTAAAAGG + Intronic
993020193 5:82583093-82583115 ACACATAGGCTCAAAATAACAGG - Intergenic
993253583 5:85558301-85558323 ACACACAGGCTCAAAATAAAGGG + Intergenic
993491854 5:88561478-88561500 AAACACATTCTGAAAATCACTGG - Intergenic
993609241 5:90033785-90033807 ACACACAGGCTCAAAATAAAGGG + Intergenic
993867800 5:93215280-93215302 ACACACAGGCTCAAAATAAAAGG + Intergenic
993871884 5:93263174-93263196 ACACACAGGCTCAAAATAAAAGG + Intergenic
993888494 5:93444323-93444345 ACACACAGGCTCAAAATAAAGGG + Intergenic
993984870 5:94585311-94585333 ACACACAGGCTCAAAATAAAGGG + Intronic
994004929 5:94826839-94826861 ACACACAGGCTCAAAATAAAGGG - Intronic
994028956 5:95118656-95118678 ATACACAGACTGAAAGTAAAGGG + Intronic
994048736 5:95338456-95338478 ACACACAGGCTCAAAATAAAGGG + Intergenic
994160540 5:96551691-96551713 ACACACAGGCTCAAAATAAAGGG + Intronic
994161104 5:96557480-96557502 ACACACAGGCTCAAAATAAAGGG + Intronic
994234493 5:97345499-97345521 ACACACAGGCTCAAAATAAAGGG + Intergenic
994289749 5:98014689-98014711 ACACACAGGCTGAAGCCCACAGG - Intergenic
994290620 5:98024874-98024896 AAACATAGGCTCAAAATAAAGGG + Intergenic
994309836 5:98256693-98256715 ACACACAGACTGAAAATAAAGGG - Intergenic
994545846 5:101165128-101165150 ACACACAGGCTCAAAATAAAGGG + Intergenic
994609751 5:102020921-102020943 AAACATAGGTTGAAAATAAAGGG + Intergenic
995110799 5:108426719-108426741 ACACACAGGCTCAAAATAAAGGG - Intergenic
995263581 5:110134029-110134051 ACACACAGGCTCAAAATAAAAGG - Intergenic
995263922 5:110136902-110136924 ACACACAGGCTCAAAATAAAGGG - Intergenic
995493255 5:112714052-112714074 TAACACAGTCTTAAACAAACTGG - Intronic
995695974 5:114878502-114878524 ACACACAGGCTCAAAATAAAGGG + Intergenic
995808092 5:116076729-116076751 TAACACTGGCTGAAACCCACAGG - Intergenic
995919726 5:117297028-117297050 AAAGACAGGCTGAACAGAACAGG - Intergenic
996066779 5:119088313-119088335 ATACACAGACTGAAAGTAAAGGG - Intronic
996242829 5:121223808-121223830 ACACACAGGCTCAAAATAAATGG + Intergenic
996274534 5:121648583-121648605 ACACACAGGCTCAAAATAAAGGG - Intergenic
996659631 5:125986284-125986306 ACACACAGACTGAAAATAAAGGG - Intergenic
996894065 5:128458091-128458113 ACACACAGGCTCAAAATAAAGGG + Intronic
996931422 5:128893735-128893757 ACATACAGGCTGAAAATAAAGGG - Intronic
996968535 5:129334324-129334346 ACACACAGACTGAAAATAACGGG + Intergenic
997136842 5:131335837-131335859 ACACACAGGCTCAAAATAAAGGG - Intronic
997771014 5:136553785-136553807 ACACATAGGCTGAAAGTAAATGG - Intergenic
997916610 5:137933095-137933117 AAATACTGGCAGAATCTAACAGG + Intronic
997920144 5:137970733-137970755 ACACACAGGCTCAAAATAAAAGG + Intronic
998691384 5:144592615-144592637 ACACACAGGCTCAAAATAAAGGG - Intergenic
999002232 5:147936909-147936931 ACACACAGACTGAAAATAAAGGG - Intergenic
999338455 5:150745063-150745085 ACACACAGGCTCAAAATAAAAGG + Intronic
999345914 5:150819525-150819547 ACACATAGGCTGAAAATAAAGGG + Intergenic
999359748 5:150973358-150973380 AAACATAGGCTCAAAATAAAGGG + Intergenic
999406057 5:151308283-151308305 ATACATAGGCTGAAAATAAAGGG - Intergenic
999502138 5:152158156-152158178 ACACAGAGGCTGAAAATAAAGGG - Intergenic
999590988 5:153145609-153145631 AAACATAGGCTGAAAGTAAATGG + Intergenic
1000860196 5:166448394-166448416 ACACACAGGCTCAAAATAAAGGG - Intergenic
1001009032 5:168081301-168081323 ACACACAGGCTCAAAATAAAGGG - Intronic
1001789059 5:174439064-174439086 ACACACAGGCTCAAAATAAAGGG + Intergenic
1002657603 5:180763320-180763342 ACACAAAGGCTGAAAGTAAAGGG + Intergenic
1003225546 6:4202384-4202406 ACACACAGGCTCAAAATAAAGGG - Intergenic
1004072651 6:12315038-12315060 AAAAACATCCTGAAACTAATGGG - Intergenic
1004107752 6:12681621-12681643 GAACAGCAGCTGAAACTAACAGG + Intergenic
1004322244 6:14641065-14641087 AAACACAGAATGAAACAAACCGG + Intergenic
1005770219 6:29062444-29062466 ACACACAGGCTCAAAATAAAGGG - Intergenic
1006198114 6:32260948-32260970 AAACATAGGCTCAAAATAAAGGG - Intergenic
1008204019 6:48630756-48630778 AAACACAGGCTGCAAGTAAATGG - Intergenic
1008302879 6:49863579-49863601 AAACACAATCTGAAACTAAAGGG - Intronic
1008468017 6:51852777-51852799 ACACACAGGCTCAAAATAAAGGG - Intronic
1008520208 6:52355855-52355877 AAACACAAGCTGAATTAAACTGG + Intergenic
1008529815 6:52446429-52446451 ACACACAGGCTCAAAATAAAGGG - Intronic
1008751836 6:54744106-54744128 ACACACAGACTGAAAGTAAAGGG - Intergenic
1008972208 6:57382225-57382247 AAACACAGAATAAAACTACCAGG - Intronic
1009161122 6:60283762-60283784 AAACACAGAATAAAACTACCAGG - Intergenic
1009282223 6:61767322-61767344 ACACACAGACTGAAAATAAAGGG - Intronic
1009492941 6:64314140-64314162 ACACACAGGCTCAAAATAAAGGG + Intronic
1009794835 6:68454187-68454209 ACACACAGGCTCAAAATAAAGGG - Intergenic
1010018550 6:71133615-71133637 AGACACAGGCTGAAAGTAAATGG + Intergenic
1010061910 6:71633073-71633095 ACACACAGACTGAAACTAAAGGG - Intergenic
1010077156 6:71812271-71812293 ACACATAGGCTGAAAATAAAGGG + Intergenic
1010276737 6:73976896-73976918 ACACATAGGCTCAAACTAAAGGG - Intergenic
1010365375 6:75044570-75044592 AAACACAGGCTGAAAGTGAAAGG + Intergenic
1010419046 6:75651201-75651223 AAAAACAGGCTGAAAAAAAAGGG - Intronic
1010421930 6:75686264-75686286 ACACACAGGCTCAAAATAAAGGG - Intronic
1010844266 6:80685479-80685501 AAACACAGGCTCAAAATAAAGGG + Intergenic
1010945881 6:81972365-81972387 ACACACAGGCTCAAAATAAAGGG + Intergenic
1011234829 6:85204268-85204290 ACACATAGGCTCAAACTAAAGGG + Intergenic
1011397344 6:86923430-86923452 AAACATAGGCTCAAAATAAAAGG + Intergenic
1011525128 6:88255883-88255905 ACACACAGGCTCAAAATAAAGGG + Intergenic
1012209074 6:96498139-96498161 ACACACAGGCTCAAAATAAAGGG - Intergenic
1012595004 6:101029219-101029241 ACACACAGGCTCAAAATAAAGGG - Intergenic
1012679871 6:102166734-102166756 ACACACAGGCTCAAAATAAAGGG - Intergenic
1013256249 6:108389246-108389268 ACACACAGGCTCAAAATAAAAGG - Intronic
1013302404 6:108816976-108816998 ACACACAGGCTCAAAATAAAGGG - Intergenic
1013320002 6:108978865-108978887 ACACACAGGCTCAAAATAAAGGG - Intergenic
1013379698 6:109555876-109555898 ACACACAGGCTCAAAATAAAGGG - Intronic
1013901674 6:115164530-115164552 ACACACAGGCTCAAAATAAAGGG - Intergenic
1014085021 6:117332112-117332134 ACACACAGGCTCAAAATAAAGGG + Intronic
1014118683 6:117697431-117697453 ACACACAGACTGAAAATAAAGGG + Intronic
1014367315 6:120561051-120561073 ACACACAGGCTCAAAATAAAGGG - Intergenic
1014369061 6:120582456-120582478 ACACACAGGCTCAAACTAAAAGG - Intergenic
1014423147 6:121269384-121269406 ACACATAGGCTGAAAATAAAGGG + Intronic
1014424487 6:121287275-121287297 ACACATAGGCTGAAAATAAAAGG + Intronic
1014504097 6:122231201-122231223 ACACATAGGCTCAAAATAACGGG - Intergenic
1014753975 6:125282786-125282808 ACACACAGGCTCAAAATAAATGG + Intronic
1015081038 6:129226203-129226225 ACACACAGGCTCAAAATAAAGGG - Intronic
1015109151 6:129571237-129571259 ACACACAGGCTCAAAATAAAGGG + Intergenic
1017181782 6:151560825-151560847 ACACACAGGCTTAAAGTAAAGGG - Intronic
1017411733 6:154174443-154174465 ACACACAGGCTCAAAATAAAGGG + Intronic
1017887232 6:158609369-158609391 AAACACAGGCTGCAGAGAACAGG + Intronic
1018340051 6:162842465-162842487 ACACACAGGCTCAAAATAAAAGG - Intronic
1019113304 6:169736186-169736208 ACACACAGGCTCAAAATAAAGGG - Intergenic
1019305024 7:329747-329769 AAACACAAATTGAAACTAAATGG + Intergenic
1019653038 7:2170926-2170948 AAACACAGGCAGAAACACATGGG + Intronic
1020343972 7:7143466-7143488 ACACATAGGCTGAAAATAAAGGG - Intergenic
1020422773 7:8027747-8027769 AAACATAGACTTAAACTAAAAGG + Intronic
1020622027 7:10529881-10529903 ACACACAGGCTAAAAATAAACGG + Intergenic
1020630020 7:10627944-10627966 ACACACAGGCTCAAAATAAAGGG + Intergenic
1020818585 7:12937941-12937963 ACACACAGGCTCAAAATAAAGGG - Intergenic
1020889847 7:13865812-13865834 GAACACAGGCTCAAAGTAAAGGG + Intergenic
1021203386 7:17752001-17752023 AGACACAGACTGAAAATAAAGGG - Intergenic
1021210081 7:17839542-17839564 CACCACAGGCTGAAAGTAAAAGG - Intronic
1021252241 7:18344639-18344661 AAACAAAGGCTGAAAATATGTGG - Intronic
1021310163 7:19084918-19084940 AAAAACAGACTGAAAGTAAAAGG + Intronic
1021933422 7:25605157-25605179 ACACATAGGCTGAAAATAAAAGG + Intergenic
1022406645 7:30096696-30096718 ACACACAGGCTCAAAATAAAGGG - Intronic
1022876419 7:34536616-34536638 AAATAAAGGCTAAAACTAAATGG + Intergenic
1022884715 7:34630996-34631018 ACACACAGGCTCAAAATAAAGGG - Intergenic
1023095535 7:36656230-36656252 CAACACGGGATGAAACTCACAGG + Intronic
1023297970 7:38736386-38736408 AAACACTGGCTTAATCTAACTGG + Intronic
1023511388 7:40957506-40957528 ACACATAGGCTGAAAATAAAGGG - Intergenic
1024017936 7:45335124-45335146 ACACACAGGCTCAAAATAAAGGG + Intergenic
1024498559 7:50074544-50074566 ACACATAGGCTGAAAATAAAGGG + Intronic
1024707855 7:51980699-51980721 CAACACAGCCTGAAACTCAGAGG + Intergenic
1025154028 7:56586929-56586951 ACACATAGGCTGAAAATAAAAGG + Intergenic
1025582721 7:62740646-62740668 ACACACAGGCTCAAAATAAAGGG - Intergenic
1027443814 7:78248546-78248568 ACACAGAGGCTGAAAATAAAGGG + Intronic
1027881007 7:83836429-83836451 AAAAACAGACGGATACTAACAGG - Intergenic
1027944263 7:84724870-84724892 ACACACAGGCTCAAAATAAAGGG + Intergenic
1028033369 7:85947789-85947811 ACACACAGACTGAAAATAAAGGG - Intergenic
1028200324 7:87954011-87954033 ACACACAGGCTCAAAATAAAAGG - Intronic
1028269078 7:88765472-88765494 CAACACAGCCTAAAACCAACTGG - Intronic
1028339274 7:89697760-89697782 ACACACAGACTGAAAATAAAGGG + Intergenic
1028395821 7:90367649-90367671 ACACACAGGCTCAAAATAAAGGG - Intronic
1028643632 7:93071685-93071707 ACACACAGGCTCAAAATAAAGGG - Intergenic
1028647138 7:93110578-93110600 ACACACAGGCTCAAAATAAAGGG + Intronic
1028652625 7:93168301-93168323 ACACACAGGCTCAAAATAAAGGG - Intergenic
1028783298 7:94762836-94762858 AAACAAAGGATGAAAATAAAGGG - Intergenic
1028802770 7:94985698-94985720 ACACACAGGCTCAAAATAAAGGG - Intronic
1028915689 7:96256340-96256362 ACACACAGGCTCAAAATAAAGGG + Intronic
1029667253 7:102003637-102003659 AATCAGAGGCTGAAACCACCTGG - Intronic
1029830049 7:103246853-103246875 ACACACAGGCTCAAAATAAAGGG + Intergenic
1030010122 7:105157441-105157463 AAACATAGGCTGAATCAAAGGGG + Intronic
1030177949 7:106673992-106674014 ACACACAGGCTCAAATTAAAGGG + Intergenic
1030245398 7:107379544-107379566 ACACACAGGCTCAAAATAAAGGG + Intronic
1030457984 7:109797241-109797263 ACACACAGGCTCAAAATAAAGGG + Intergenic
1030706531 7:112698203-112698225 AAACACAGACTGAAAATAAAGGG - Intergenic
1030734205 7:113025530-113025552 ACACATAGACTGAAAATAACAGG - Intergenic
1030906063 7:115184400-115184422 AAACATAGGCTCAAAATAAAGGG - Intergenic
1031699255 7:124902798-124902820 AAACATAGGCTCAAATTAAAGGG + Intronic
1031865048 7:127029703-127029725 AAACATAGGCTCAAAATAAAGGG - Intronic
1032289907 7:130579621-130579643 ACACACAGGCTCAAAATAAAAGG + Intronic
1032629873 7:133637862-133637884 AAACACCGATTGCAACTAACTGG + Intronic
1032994159 7:137426672-137426694 ACACACAGGCTCAAAATAAAAGG + Intronic
1033565268 7:142572077-142572099 AAACATAGGCTCAAAATAAACGG + Intergenic
1033787028 7:144744312-144744334 AAACACATGTTTAAACAAACTGG - Intronic
1033975548 7:147096087-147096109 AAACACAGGCAGATACATACTGG + Intronic
1034098215 7:148428632-148428654 AAACATAGGCTCAAAATAAAGGG + Intergenic
1034133978 7:148748321-148748343 AAACAAAGGTTGAAAATAAAGGG + Intronic
1034208755 7:149343705-149343727 ACACACAGGCTCAAAATAAAGGG - Intergenic
1034563079 7:151894184-151894206 AGACACAGGCAGAAACCCACAGG + Intergenic
1035573952 8:692616-692638 CAACACAGGAGGAAAATAACAGG + Intronic
1036070048 8:5432143-5432165 ATACACAGGCTGAAAGTGAAAGG + Intergenic
1036285311 8:7439742-7439764 TCACACAGGCTGAAAGTAAAGGG - Intergenic
1036336165 8:7871787-7871809 TCACACAGGCTGAAAGTAAAGGG + Intergenic
1036505900 8:9355557-9355579 AAATACAAGCCTAAACTAACTGG - Intergenic
1036815006 8:11895858-11895880 AAACACAGTCTGAAGCAAAATGG + Intergenic
1036913615 8:12783130-12783152 ACACACAGACTGAAAGTAAAGGG - Intergenic
1037249354 8:16875155-16875177 ACACACAGGCTCAAAATAAAGGG - Intergenic
1037285243 8:17292336-17292358 ACACACAGGCTTAAAATAAAGGG - Intronic
1038936199 8:32255061-32255083 ACACACAGGCTCAAAATAAAGGG - Intronic
1039169726 8:34729580-34729602 AAATACAGGCAGAATGTAACAGG + Intergenic
1039399306 8:37255215-37255237 AATTTCAGGCTAAAACTAACAGG + Intergenic
1039420918 8:37439215-37439237 ACACACAGACTGAAAATAAAGGG - Intergenic
1039640537 8:39216262-39216284 ATACACAGACTGAAAATAAATGG - Intronic
1039685701 8:39799896-39799918 ACACACAGGCTCAAAATAAAGGG - Intronic
1039707231 8:40020264-40020286 ACACATAGGCTGAAAATAAAGGG - Intergenic
1039802011 8:40966103-40966125 ACACATAGGCTGAAAATAAAGGG + Intergenic
1040899138 8:52400270-52400292 ATACACAGGCTGAAAGTGAAGGG - Intronic
1041567354 8:59294207-59294229 AATCACTGGCTGAATCTAGCAGG - Intergenic
1041579679 8:59444420-59444442 AAACATAGACTGAAAATAAAGGG - Intergenic
1041665701 8:60442823-60442845 ACACATAGGCTCAAACTAAAGGG - Intergenic
1041742176 8:61167628-61167650 AAAATGAGGCTGAAACTTACTGG + Intronic
1041752068 8:61271884-61271906 ACACACAGGCTCAAAATAAAAGG - Intronic
1041771604 8:61478686-61478708 AAACATAGGCTCAAAATAAAGGG - Intronic
1041959141 8:63592025-63592047 ACACACAGGCTGAAAGTGAAGGG - Intergenic
1042479044 8:69282450-69282472 ACACACAGGCTCAAAATAAAGGG + Intergenic
1042541295 8:69909541-69909563 ACACACAGGCTCAAAATAAAGGG + Intergenic
1042740648 8:72040993-72041015 GAACACAGGCTGAAATTGAACGG + Intronic
1043200689 8:77365818-77365840 ACACACAGGCTCAAAATAAAGGG + Intergenic
1043368039 8:79558527-79558549 ACACATAGGCTGAAAATAAAGGG - Intergenic
1043715137 8:83473954-83473976 AAACACAGACTGAAATAAATGGG + Intergenic
1043761416 8:84073704-84073726 AACCACAGGCTCAAAGTAAAGGG - Intergenic
1044007723 8:86958697-86958719 ACACATAGGCTGAAAATAAAGGG - Intronic
1044209851 8:89537369-89537391 AAACATAGGCTCAAAATAAAAGG + Intergenic
1044780006 8:95734407-95734429 GAATGCAGGCTGAAACCAACAGG + Intergenic
1044905945 8:97003126-97003148 ACACACAGGCTCAAAATAAAGGG - Intronic
1045029236 8:98119104-98119126 ATACACAGCCTGAAACTATTGGG + Intronic
1045450465 8:102319209-102319231 ACACACAGGCTCAAAATAAAAGG + Intronic
1045590199 8:103585006-103585028 ACACACAGACTGAAAATAAAGGG + Intronic
1045775045 8:105792954-105792976 ACACACAGGCTCAAAATAAAAGG - Intronic
1045797924 8:106067336-106067358 AAACATAGGCTCAAAATAAAGGG + Intergenic
1046330966 8:112714195-112714217 ACACACAGGCTCAAAATAAAAGG + Intronic
1047805898 8:128359681-128359703 AAACACAGATTCACACTAACAGG + Intergenic
1048322725 8:133413106-133413128 ACACATAGGCTGAAAGTAAAAGG - Intergenic
1048758180 8:137762323-137762345 ACACACAGGGTGAAAATTACTGG + Intergenic
1048875232 8:138831891-138831913 AAAATGAGGCTGAAACTTACTGG + Intronic
1049067007 8:140324176-140324198 AGACACAGACTGAAAATAAAAGG + Intronic
1049136444 8:140905297-140905319 ACACACAGGCTCAAAATAAAGGG + Intronic
1049485055 8:142852209-142852231 ACACATAGGCTGAAAATAAATGG + Intronic
1049837995 8:144751833-144751855 AAAGACAGGTTGAAATTAAATGG + Intronic
1049899211 9:141814-141836 ACACACAGGCTCAAAATAAAGGG + Intronic
1050047335 9:1560689-1560711 AAACATAGGCTCAAAATAAAGGG + Intergenic
1050492620 9:6204799-6204821 ACACACAGGCTCAAAATAAAGGG + Intergenic
1050671804 9:8006242-8006264 ACACACAGGCTCAAAATAAAGGG - Intergenic
1050794376 9:9519245-9519267 AAACAAAGGCTGAAAATCAATGG + Intronic
1050824906 9:9933350-9933372 ACACACAGGCTCAAAATAAAAGG + Intronic
1050956221 9:11664707-11664729 ACACATAGGCTGAAAGTAAAGGG - Intergenic
1050956604 9:11669127-11669149 ACACACAGGCTCAAAATAAAAGG - Intergenic
1051007817 9:12369124-12369146 ACTTACAGTCTGAAACTAACTGG + Intergenic
1051035939 9:12745588-12745610 ACACACAGGCTCAAAATAAAGGG - Intergenic
1051082043 9:13305403-13305425 AAACATAGGCTCAAAATAAAGGG - Intergenic
1051489424 9:17645214-17645236 ACACACAGGCTCAAAATAAAGGG - Intronic
1051615047 9:18999228-18999250 ACACACAGGCTTAAAATAAAGGG + Intronic
1051674310 9:19544300-19544322 AAACATAGGCTTAAAATAAAGGG - Intronic
1051790765 9:20799716-20799738 AAACATAGGCTCAAAATAAAGGG - Intronic
1051974526 9:22933509-22933531 AAAATGAGGCTGAAACTTACTGG - Intergenic
1052106600 9:24524908-24524930 ACACACAGGCTCAAAATAAAGGG - Intergenic
1052107649 9:24538966-24538988 AAACACATGCTCCAACTAAGAGG + Intergenic
1052145493 9:25043834-25043856 ACACACAGGCTCAAAATAAAGGG - Intergenic
1052182293 9:25544494-25544516 AAAAATAGGCTGAAACCATCAGG - Intergenic
1052724691 9:32215697-32215719 ACACACAGGCTCAAAATAAAGGG - Intergenic
1053129287 9:35605881-35605903 AACCAGAGGCTGAAACTAGGGGG + Intronic
1053677414 9:40447904-40447926 AAACACACACACAAACTAACAGG - Intergenic
1053927169 9:43074058-43074080 AAACACAAACACAAACTAACAGG - Intergenic
1054286303 9:63177008-63177030 AAACACACACACAAACTAACAGG + Intergenic
1054290487 9:63283431-63283453 AAACACACACACAAACTAACAGG - Intergenic
1054388512 9:64587972-64587994 AAACACACACACAAACTAACAGG - Intergenic
1054507208 9:65928391-65928413 AAACACACACACAAACTAACAGG + Intergenic
1055341318 9:75287046-75287068 ACACATAGGCTGAAAATAAAGGG - Intergenic
1055451749 9:76437216-76437238 AAAATAAGGCTGAAACTTACTGG + Intronic
1056003296 9:82240874-82240896 AAACATAGGCTCAAAATAAAGGG - Intergenic
1056015209 9:82378134-82378156 ACACACAGGCTCAAAATAAAGGG + Intergenic
1056059225 9:82865719-82865741 AAACATAGACTGAAAGTAAAAGG + Intergenic
1056089006 9:83186092-83186114 AAAGATCTGCTGAAACTAACGGG + Intergenic
1056952221 9:91050267-91050289 ATACATAGGCTGAAAGTAAAGGG + Intergenic
1056994233 9:91441371-91441393 AAACATAGACTGAAAGTAAGAGG - Intergenic
1057175361 9:92993358-92993380 ACACATAGGCTGAAAGTGACAGG - Intronic
1057289753 9:93797407-93797429 ATATACAGGCAGAAACTATCTGG - Intergenic
1057711972 9:97453666-97453688 ACACACAGGCTCAAAATAAAGGG + Intronic
1058029494 9:100179412-100179434 ACACACAGGCTGAAAATAAAGGG + Intronic
1058034350 9:100235235-100235257 ACACACAGGCTCAAAATAAACGG - Intronic
1058189877 9:101900363-101900385 AAAACCAGGCTGTATCTAACAGG - Intergenic
1058266231 9:102902049-102902071 ACACACAGGCTGAAAATAAAGGG + Intergenic
1058374538 9:104307190-104307212 ACACACAGGCTCAAAATAAAGGG + Intergenic
1058413145 9:104756369-104756391 ATACAAAGGCTCAAACTATCTGG + Intronic
1058492588 9:105517933-105517955 AAACATAGGCTCAAAATAAAGGG + Intronic
1058614532 9:106811439-106811461 ACACATAGGCTGAAAATAAAGGG + Intergenic
1058925917 9:109664057-109664079 ACACACAGGCTCAAAATAAACGG - Intronic
1059076577 9:111199436-111199458 AAACACAGGCTCAAAATAAAGGG + Intergenic
1059326256 9:113505582-113505604 AAACATAGTCTGGAACTAAAAGG + Intronic
1059745988 9:117202208-117202230 ACACACAGGCTTAAAATAAAGGG - Intronic
1059865247 9:118506803-118506825 ACACACAGGCTCAAAATAAAGGG + Intergenic
1059871936 9:118587330-118587352 AAAAACTGGCTGAAACAAAGGGG - Intergenic
1059945264 9:119403109-119403131 TAAAACAGGCTGAACCCAACAGG - Intergenic
1059954821 9:119504453-119504475 ACACACAGGCTCAAAATAAAGGG + Intronic
1060026804 9:120179230-120179252 ACACACAGGCTCAAAATAAAGGG + Intergenic
1060334891 9:122712067-122712089 ACACACAGGCTCAAAATAAAGGG + Intergenic
1061273234 9:129555736-129555758 AAAATCAGGCTGAAACCTACCGG + Intergenic
1062063368 9:134511698-134511720 AAACACAGCCTGAAAATTAAAGG - Intergenic
1062296399 9:135830338-135830360 ACACACAGGCTGAAAGTGAAGGG + Intronic
1203526609 Un_GL000213v1:96717-96739 ACACACAGGCTCAAAATAAAGGG + Intergenic
1203408290 Un_KI270538v1:68034-68056 ACACATAGGCTCAAACTAAAAGG + Intergenic
1186431171 X:9505570-9505592 ACACACAGGCTCAAAATAAAGGG + Intronic
1186448922 X:9655862-9655884 AAACCCAGGCTCAAATGAACAGG - Intronic
1186593471 X:10955211-10955233 ACACACAGGCTCAAAATAAAGGG + Intergenic
1186847687 X:13546781-13546803 AAAGACATGCCGAAATTAACAGG - Intergenic
1187513465 X:19944143-19944165 ACACACAGGCTCAAAATAAAAGG - Intronic
1187644373 X:21330587-21330609 ACACACAGGCTCAAAATAAATGG + Intergenic
1187839718 X:23474874-23474896 ACACACAGGCTCAAAATAAAGGG - Intergenic
1188037685 X:25337299-25337321 ACACACAGGCTCAAAATAAAGGG - Intergenic
1188049155 X:25463470-25463492 ACACACAGGCTGAAAGTGAAGGG - Intergenic
1188296599 X:28457458-28457480 ACACACAGGCTCAAAATAAAGGG + Intergenic
1188370642 X:29365705-29365727 AAATAAAGGAAGAAACTAACAGG + Intronic
1188411553 X:29878221-29878243 AAACTTAAGCTTAAACTAACTGG + Intronic
1188733803 X:33686408-33686430 ACACACAGACTGAAATTAAAGGG - Intergenic
1188793819 X:34437923-34437945 ACACACAGGCTCAAAATAAAGGG + Intergenic
1188851338 X:35136396-35136418 ATACACAGGCTCAAAATAAAGGG - Intergenic
1188998864 X:36920995-36921017 ACACACAGACTGAAAATAAAAGG - Intergenic
1189006102 X:36997001-36997023 ACACACAGGCTGAAAGTGAAAGG + Intergenic
1189584967 X:42450119-42450141 ACACATAGGCTGAAAATAAAGGG + Intergenic
1189770809 X:44425195-44425217 ACACACAGGCTCAAAATAAAGGG - Intergenic
1189824336 X:44901855-44901877 AAAAATAGGTTGAAACTAAAAGG - Intronic
1190415132 X:50173336-50173358 AAACACAGAGAGAAAGTAACAGG + Intergenic
1190422517 X:50300002-50300024 ACACACAGGCTCAAAATAAAGGG - Intronic
1190506119 X:51127495-51127517 ACACACAGGCTCAAAATAAAGGG + Intergenic
1190519658 X:51264269-51264291 ACACACAGGCTCAAAATAAAAGG + Intergenic
1190529902 X:51363883-51363905 ACACACAGGCTCAAAATAAAGGG + Intergenic
1190944868 X:55082378-55082400 ACACACAGGCTCAAAATAAAGGG - Intergenic
1191592654 X:62905052-62905074 ACACACAGGCTCAAAATAAAGGG - Intergenic
1191609453 X:63096126-63096148 ACACACAGGCTCAAAATAAAGGG - Intergenic
1191657038 X:63609297-63609319 ACACACAGGCTCAAAGTAAAGGG + Intergenic
1191676862 X:63800026-63800048 ACACACAGGCTCAAAATAAAGGG + Intergenic
1191799715 X:65065010-65065032 ACACATAGGCTGAAAATAAAGGG - Intergenic
1191816958 X:65255810-65255832 ACACACAGGTTGAAAGTAAAAGG + Intergenic
1191942125 X:66491799-66491821 ACACACAGGCTCAAAATAAAGGG + Intergenic
1191972353 X:66831025-66831047 ACACATAGGCTGAAAGTAAAAGG - Intergenic
1191981306 X:66928720-66928742 AAACATAGGCTCAAAATAAAAGG - Intergenic
1192027738 X:67472955-67472977 ACACACAGGCTGAAAATAAAAGG - Intergenic
1192097413 X:68227029-68227051 ACACACAGGCTCAAAATAAAGGG + Intronic
1192304172 X:69941641-69941663 AAACATAGACTGAAAATAAAGGG - Intronic
1192335269 X:70214268-70214290 ACACACAGGCTCAAAATAAAGGG - Intergenic
1192393861 X:70757894-70757916 AAACATAGGCTCAAAATAAAGGG + Intronic
1192406341 X:70890058-70890080 ACACACAGACTGAAAATAAAGGG + Intronic
1192700534 X:73466258-73466280 ATACACAGGCTGAAAATAAAAGG - Intergenic
1192701947 X:73483388-73483410 ACACACAGGCTCAAAATAAAAGG + Intergenic
1192943020 X:75933367-75933389 ACACATAGGCTGAAAATAAAGGG - Intergenic
1192984042 X:76377421-76377443 ACACATAGGCTGAAAATAAAAGG - Intergenic
1193033724 X:76926630-76926652 ACACACAGGCTCAAAATAAAAGG + Intergenic
1193036061 X:76952427-76952449 ACACACAGGCTCAAAATAAAGGG + Intergenic
1193048155 X:77074982-77075004 ACACACAGGCTCAAAATAAAGGG - Intergenic
1193056383 X:77155904-77155926 ACACACAGGCTCAAAATAAAGGG + Intergenic
1193066962 X:77270304-77270326 ACACATAGGCTCAAACTAAAGGG + Intergenic
1193098586 X:77581340-77581362 ACACATAGGCTGAAAATAAAGGG + Intronic
1193164064 X:78261903-78261925 AAACAGAGGCTCAAAATAAGGGG - Intergenic
1193219685 X:78909644-78909666 AAACATAGACTGAAAATAAAGGG - Intergenic
1193409553 X:81145774-81145796 AAACATAGGCTCAAAATAAAGGG + Intronic
1193605689 X:83565586-83565608 ACACATAGGCTGAAAATAAAGGG - Intergenic
1193663919 X:84292273-84292295 ACACATAGGTTGAAACTAATGGG - Intergenic
1193672002 X:84398348-84398370 AAACATAGGCTCAAAATAAAGGG + Intronic
1193673785 X:84421692-84421714 ACACATAGGCTGAAAATAAAGGG + Intronic
1193780587 X:85697063-85697085 ACACACAGGCTCAAAATAAAGGG - Intergenic
1193835474 X:86337835-86337857 ACACACAGGCTCAAAATAAAGGG + Intronic
1194218561 X:91163942-91163964 ACACACAGACTGAAAATAAAGGG - Intergenic
1194266092 X:91754933-91754955 AAACATAGGCTCAAAATAAAAGG + Intergenic
1194420139 X:93662721-93662743 AAACATAGGCCGAAAATAAAGGG + Intergenic
1194439136 X:93908440-93908462 ACACACAGGCTGAAAATTAAGGG - Intergenic
1194446956 X:94000272-94000294 ACACACAGGCTCAAAATAAAAGG - Intergenic
1195171992 X:102278561-102278583 ACACACAGGCTAAAAATAAAGGG - Intergenic
1195186868 X:102408532-102408554 ACACACAGGCTAAAAATAAAGGG + Intronic
1195248944 X:103024332-103024354 ACACACAGGCTCAAAATAAAAGG - Intergenic
1195289891 X:103422414-103422436 ACACACAGGCTGAAAATAAAGGG - Intergenic
1195414817 X:104608718-104608740 ACACACAGGCTCAAAATAAAGGG - Intronic
1195455265 X:105061900-105061922 AGACACAGACTGAAAATAAAGGG - Intronic
1195712743 X:107787368-107787390 AAACATAAGCTGAAACAGACTGG - Intronic
1195846176 X:109231057-109231079 AAACATAGGCTCAAAATAAAGGG + Intergenic
1195985811 X:110628590-110628612 ACACACAGGCTCAAAATAAAGGG + Intergenic
1196036994 X:111156239-111156261 AAACGCAGGCTTAAACTGATAGG + Intronic
1196148999 X:112351736-112351758 ACACATAGGCTGAAAATAAAGGG - Intergenic
1196510701 X:116508539-116508561 AAACAAATGCAGAAATTAACAGG - Intergenic
1196537140 X:116860235-116860257 AGACACAGACTGAAAATAAAGGG - Intergenic
1196546352 X:116968683-116968705 ACACACAGGCTCAAAATAAAAGG - Intergenic
1196607069 X:117669566-117669588 ACACACAGGCTCAAAATAAAGGG - Intergenic
1197124421 X:122927345-122927367 AAACATAGGATGAATCTAGCTGG - Intergenic
1197362929 X:125529861-125529883 AAACATAGACTGAAAATAAAGGG - Intergenic
1197491277 X:127120571-127120593 ACACATAGGCTGAAAATAAAAGG - Intergenic
1197502024 X:127254334-127254356 ACACATAGGCTGAAAATAAAAGG - Intergenic
1197847274 X:130816018-130816040 ACACACAGGCTCAAAATAAAGGG + Intronic
1198077709 X:133210497-133210519 AGGCACAGGCTGAAAGTAACAGG + Intergenic
1198166243 X:134060498-134060520 ACACACAGGCTCAAAATAAAGGG - Intergenic
1198335598 X:135663391-135663413 AAACATAGGCTCAAAATAAAGGG - Intergenic
1198856017 X:141017632-141017654 ACACATAGGCTGAAAATAAAGGG - Intergenic
1198906674 X:141569735-141569757 ACACATAGGCTGAAAATAAAGGG + Intergenic
1198916970 X:141683407-141683429 ACACATAGGCTGAAAATAAAGGG + Intronic
1199442761 X:147887222-147887244 ACACACAGACTGAAAATAAAGGG - Intergenic
1200378681 X:155811053-155811075 AAACATAGGCTCAAAATAAAGGG + Intergenic
1200379762 X:155822507-155822529 ACACACAGACTGAAAATAAAGGG + Intergenic
1200388262 X:155916224-155916246 ACACACAGGCTCAAAATAAAGGG - Intronic
1200537836 Y:4420889-4420911 ACACATAGGCTGAAAATAAAAGG + Intergenic
1200555074 Y:4627699-4627721 ACACACAGACTGAAAATAAAGGG - Intergenic
1200732350 Y:6756537-6756559 ACACACAGGCTCAAAATAAAGGG - Intergenic
1200771858 Y:7133661-7133683 ACACACAGGCTCAAAATAAAGGG - Intergenic
1200871166 Y:8100345-8100367 ACACATAGGCTCAAACTAAAGGG - Intergenic
1200903462 Y:8457267-8457289 ACACACAGGCTCAAAATAAAAGG - Intergenic
1201067368 Y:10110827-10110849 ACACACAGGCTCAAAATAAAGGG - Intergenic
1201410405 Y:13693468-13693490 AAACATAGGCTCAAAATAAAAGG + Intergenic
1201413473 Y:13724210-13724232 ACACATAGGCTGAAAATAAAAGG + Intergenic
1201518681 Y:14847795-14847817 AAACCCTGCCTGAAATTAACAGG + Intergenic
1201527733 Y:14955022-14955044 ACACACAGGCTCAAAATAAAAGG + Intergenic
1201563294 Y:15341074-15341096 ACACACAGGCTCAAAATAAAGGG - Intergenic
1201732075 Y:17215006-17215028 ACACACAGGCTCAAAATAAAGGG + Intergenic
1201971097 Y:19796241-19796263 AACCACAGGCTCAAAATAAAGGG - Intergenic
1202064452 Y:20923713-20923735 ACACACAGGCTCAAAATAAAAGG - Intergenic
1202327497 Y:23706736-23706758 ACACACAGGCTCAAAATAAAAGG + Intergenic
1202543273 Y:25963316-25963338 ACACACAGGCTCAAAATAAAAGG - Intergenic