ID: 919342999

View in Genome Browser
Species Human (GRCh38)
Location 1:196337573-196337595
Sequence CACTGTGTTTGAGGCACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 201}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919342994_919342999 5 Left 919342994 1:196337545-196337567 CCTCATCTCCTACTATTCTTCCA 0: 1
1: 2
2: 11
3: 79
4: 584
Right 919342999 1:196337573-196337595 CACTGTGTTTGAGGCACAAAGGG 0: 1
1: 0
2: 1
3: 32
4: 201
919342995_919342999 -3 Left 919342995 1:196337553-196337575 CCTACTATTCTTCCAGCATTCAC 0: 1
1: 0
2: 0
3: 16
4: 231
Right 919342999 1:196337573-196337595 CACTGTGTTTGAGGCACAAAGGG 0: 1
1: 0
2: 1
3: 32
4: 201
919342992_919342999 24 Left 919342992 1:196337526-196337548 CCTCTTTCTACCTGTTCGTCCTC 0: 1
1: 0
2: 0
3: 26
4: 353
Right 919342999 1:196337573-196337595 CACTGTGTTTGAGGCACAAAGGG 0: 1
1: 0
2: 1
3: 32
4: 201
919342993_919342999 14 Left 919342993 1:196337536-196337558 CCTGTTCGTCCTCATCTCCTACT 0: 1
1: 0
2: 1
3: 30
4: 323
Right 919342999 1:196337573-196337595 CACTGTGTTTGAGGCACAAAGGG 0: 1
1: 0
2: 1
3: 32
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919342999 Original CRISPR CACTGTGTTTGAGGCACAAA GGG Intronic
900373992 1:2345041-2345063 CACTGTCTTCGGGGCACATATGG - Intronic
901274463 1:7980379-7980401 CAATGTTTTTGAGGCACTAAAGG - Intronic
905177235 1:36144973-36144995 CATTTTGTTTGGGGCACTAACGG - Intronic
906750602 1:48255829-48255851 CCCTGTGCTTCAGCCACAAAAGG - Intergenic
907332901 1:53682916-53682938 AACTCTGTTAGAGGCACGAAGGG + Intronic
912523226 1:110261517-110261539 CACTATTTTTGAGCCACTAAAGG + Intronic
915624515 1:157106537-157106559 CTCTGTGTTGGGGGGACAAAGGG - Intergenic
915641361 1:157229637-157229659 CACCGAGTTTGAGGCACCAGTGG + Intergenic
917757993 1:178122399-178122421 GACTGTGTTTGGGTCAGAAATGG + Intronic
919342999 1:196337573-196337595 CACTGTGTTTGAGGCACAAAGGG + Intronic
924145172 1:241066946-241066968 CACTGTATTTCAGGCCCAGAGGG - Intronic
1063011881 10:2029832-2029854 CACTGTGAATAAAGCACAAATGG + Intergenic
1063931393 10:11031941-11031963 CACTGTGATTGAGTCAACAATGG - Intronic
1064691261 10:17920712-17920734 CCCTGTGTCTGCAGCACAAATGG + Intergenic
1065148424 10:22797067-22797089 CACTTGGGTTGAGGCAAAAAAGG - Intergenic
1066122014 10:32298269-32298291 CACTTAGTTTGAGTCATAAATGG - Intronic
1072195784 10:93116266-93116288 CACTGTCTTTGAGGGGCACAAGG - Intergenic
1072907769 10:99470907-99470929 CACTGGATATGAGGCAAAAAAGG + Intergenic
1074622956 10:115145255-115145277 CACTATGGTTGAGGCAGAAAAGG - Intronic
1075486269 10:122823941-122823963 CACTGTGTCTCAGGCACAGTGGG + Intergenic
1076816517 10:132917726-132917748 CATTTTGTTTGAAGCACAGAAGG + Intronic
1078904723 11:15673062-15673084 CACAGTGTTTGACACATAAAAGG + Intergenic
1080759043 11:35229960-35229982 TACTTTGTCAGAGGCACAAAAGG + Exonic
1080873647 11:36258353-36258375 CAATGTGATTGAGGAACAGAGGG + Intergenic
1084742347 11:71147817-71147839 CTCTGTGTTTGAAGCAGAGAGGG - Intronic
1087053380 11:93908224-93908246 AACTGTTTTTGGGGAACAAATGG + Intergenic
1088317936 11:108526463-108526485 CACGGGGTCTGAGGCAGAAAAGG - Intronic
1088637306 11:111835260-111835282 CACTGTCTTTGTGACCCAAAAGG + Intronic
1089644696 11:119871082-119871104 TTCTGTGTTTGAGGAGCAAAGGG + Intergenic
1090947849 11:131447809-131447831 CTCTGTGCTGGAGGCCCAAATGG - Intronic
1091372519 11:135072812-135072834 CCCTGTTTGTGAGACACAAATGG + Intergenic
1092003047 12:5046945-5046967 CATTGTCTATGAGGCACCAAGGG - Intergenic
1092569686 12:9708751-9708773 CACTGGGTCTCAGGGACAAAAGG + Intergenic
1094011135 12:25811009-25811031 CACTGTTTATGATGGACAAAAGG - Intergenic
1096365217 12:51023621-51023643 GAGTGTGTTTGAGGCAGAAAGGG - Intronic
1097951150 12:65429427-65429449 CAGTGTGGTTGAAGCACAAGGGG + Intronic
1098540205 12:71647219-71647241 CACTGTGTTTGACGTATAACAGG - Intronic
1101860503 12:108478654-108478676 GAATGTGTTTGTGGAACAAACGG + Intergenic
1102213509 12:111144193-111144215 AACTGTGTTTGGGACACAGAAGG + Intronic
1102382995 12:112483525-112483547 CAATGTGTTTGAGTCAGCAAAGG + Intronic
1105612240 13:21978402-21978424 CACTGCATGTCAGGCACAAAGGG - Intergenic
1107376788 13:39812253-39812275 GTCTGTGTTTGTGGCAGAAAGGG + Intergenic
1107864375 13:44689117-44689139 CATTGTGTTTGAGGCACTGGGGG + Intergenic
1110053472 13:70935169-70935191 CACTGAGATTGGGGTACAAATGG + Intergenic
1113223194 13:108129070-108129092 AAAGGTTTTTGAGGCACAAATGG - Intergenic
1113548190 13:111170785-111170807 CTGTGTGTTTGAGGTAAAAATGG + Intronic
1113913215 13:113854503-113854525 CTCTGTGTTTGGGGCAGAGACGG - Intronic
1114140651 14:19906179-19906201 CACTATGTTTGGGCCACAGAAGG - Intergenic
1115190995 14:30747026-30747048 CACTGCTTATGAGGCACAAGAGG + Intergenic
1116307141 14:43271762-43271784 CACTGCCTTTAAGACACAAATGG + Intergenic
1116315286 14:43380631-43380653 CAGTGTGTTGAAAGCACAAAAGG - Intergenic
1118327702 14:64792777-64792799 CCCTTTGTTTGAGGAACACAAGG + Intronic
1120171662 14:81252211-81252233 CTCTTTGTTTGAGTTACAAAAGG - Intergenic
1120668782 14:87339765-87339787 CACTGTGTCTAAGACATAAAAGG + Intergenic
1121849717 14:97209799-97209821 CATTGTGTTTGGGGGAGAAAAGG + Intergenic
1124081546 15:26502950-26502972 CATTAAGTTTGAGTCACAAATGG - Intergenic
1127323604 15:57872327-57872349 AATTGTGTTTGGGGCACAAATGG - Intergenic
1135203340 16:20459813-20459835 CACTGTATTTTAAGCACAAGGGG + Intronic
1135215663 16:20565125-20565147 CACTGTATTTTAAGCACAAGGGG - Intronic
1137601767 16:49761092-49761114 CACTGTGTTTGGGAGGCAAAGGG - Intronic
1137902880 16:52288112-52288134 CAATGTGTTTGAGGCACTGAAGG - Intergenic
1139138904 16:64237408-64237430 GACAGTGTTAGAGGCACAAAAGG + Intergenic
1139953546 16:70683046-70683068 CACTGTGCTTGGGGCAGAACTGG - Intronic
1141346629 16:83252606-83252628 CACTGTGGCTGAGACACCAACGG - Intronic
1144185580 17:12792097-12792119 CAGTGTGTTTGGGGCAAGAAAGG - Intronic
1146182161 17:30705486-30705508 CTGTGTGTTTGAGGCGTAAATGG + Intergenic
1147950428 17:44104685-44104707 TAATGTTTTTGAGGGACAAAAGG - Intronic
1149109194 17:53006601-53006623 CACAGTGTTTGACACATAAAGGG + Intergenic
1149427985 17:56573614-56573636 CACTCTATTTGAGGCCCAAGGGG - Intergenic
1149877846 17:60255889-60255911 CAATATATTTGAGGCATAAAAGG - Intronic
1151398973 17:73843357-73843379 CACTGTGTTTGGGCCACCCAGGG + Intergenic
1152447431 17:80353971-80353993 CACTGTGTCAGTGGCAGAAACGG + Intronic
1153476262 18:5501966-5501988 CAGAGTATTTGAGGCATAAATGG - Intronic
1153780041 18:8486361-8486383 GACTGTGTTTGTGACACATAGGG + Intergenic
1156516214 18:37682852-37682874 GAATGTGTTTGAGGCACAGAAGG + Intergenic
1157135646 18:45051960-45051982 GTCTGTGTTTGAGGCATGAAAGG - Intronic
1160134494 18:76261001-76261023 CACTGTATTTCTGGCACAAAGGG + Intergenic
1161442152 19:4298070-4298092 CGCTGTGGTTGAGGCTCACAGGG + Exonic
1161456717 19:4373287-4373309 CACTGTGTGTGATGCACGGAGGG + Intronic
1162976673 19:14210316-14210338 CTGTGTGTTTGAGGCGTAAATGG - Intergenic
1167342285 19:48922913-48922935 CACTGTCTTTGAGGCATCACTGG - Exonic
925662349 2:6216319-6216341 CATTGAGCTTGAGGAACAAAAGG + Intergenic
926362305 2:12101547-12101569 CCCAGAGTTTGAGGCAGAAACGG - Intergenic
928460678 2:31469483-31469505 TACTGTGTTTGTGGCAGATAAGG + Intergenic
930992907 2:57682059-57682081 CACTGTATTTGAGGGAGAAAAGG - Intergenic
933381129 2:81547123-81547145 AACTGTGATTGAGAAACAAAAGG - Intergenic
933798292 2:85938867-85938889 CACTGTGTCTAAGGCAGAAAGGG + Intergenic
934042407 2:88138691-88138713 ACCAGAGTTTGAGGCACAAAGGG - Intergenic
939105754 2:137946645-137946667 CACAGTGTTTGATGCCAAAAAGG + Intergenic
941853342 2:170206232-170206254 CAATGAGTTTGAAGGACAAATGG - Intronic
944240042 2:197477361-197477383 CACTGTGTTTGTTGTATAAAGGG - Intergenic
945083251 2:206107038-206107060 CACTGTATTAGAAGCATAAAAGG + Intergenic
945191097 2:207188218-207188240 CATTGTCTTTGAAACACAAATGG + Intergenic
946873114 2:224102504-224102526 CAAAGTGCTTGAGGCAGAAAAGG + Intergenic
947622475 2:231599509-231599531 CCCTGTTTTTCAGGCAGAAAGGG - Intergenic
948652522 2:239457295-239457317 CACTGTGTTGGAGGCACAAGAGG + Intergenic
1171292361 20:23989616-23989638 CACTGTCTTTGAGGAACTGAGGG - Intergenic
1171292554 20:23990543-23990565 CACTGTGTTTGAGGAACTGAGGG - Intergenic
1173738740 20:45380669-45380691 CACTGTGTGCTAGGCACTAAGGG + Intronic
1174521557 20:51134938-51134960 TATTGTGTCTGAGCCACAAAAGG + Intergenic
1177999930 21:28149703-28149725 CACTAGGCTTGAGGCAAAAATGG - Intergenic
1180823430 22:18847377-18847399 CACTGTCTTTGAGGAACTGAGGG - Exonic
1181123854 22:20690476-20690498 CACTGTCTTTGAGGAACTGAGGG - Intergenic
1181124043 22:20691405-20691427 CACTGTGTTTGAGGAACTGAGGG - Intergenic
1181189117 22:21126239-21126261 CACTGTGTTTCAGGAACTGAGGG + Exonic
1181189312 22:21127169-21127191 CACTGTCTTTGAGGAACTGAGGG + Exonic
1181209886 22:21283326-21283348 CACTGTCTTTGAGGAACTGAGGG - Intergenic
1181210082 22:21284256-21284278 CACTGTGTTTCAGGAACTGAGGG - Intergenic
1181322563 22:22019592-22019614 CATTGTGTTGGAGGCCCACAAGG + Intergenic
1181399441 22:22642689-22642711 CACTGTGTTTGAGGAACTGAGGG + Intergenic
1181399629 22:22643618-22643640 CACTGTCTTTGAGGAACTGAGGG + Intergenic
1181649787 22:24252450-24252472 CACTGTCTTTGAGGAACTGAGGG - Intergenic
1181649976 22:24253379-24253401 CACTGTGTTTGAGGAACTGAGGG - Intergenic
1181707587 22:24658296-24658318 CACTGTCTTTGAGGAACTGAGGG + Intergenic
1183039939 22:35170413-35170435 CCCTGTGTTTGTGGAATAAATGG - Intergenic
1183601476 22:38843039-38843061 CACGGTGACTGAGGCACAGAGGG - Intronic
1184801993 22:46766874-46766896 CACTGAGTTTGATGCAAAAAAGG - Intronic
1185017261 22:48352050-48352072 CTCTTTGTTTGACACACAAAAGG + Intergenic
1203216865 22_KI270731v1_random:11177-11199 CACTGTGTTTCAGGAACTGAGGG + Intergenic
1203217060 22_KI270731v1_random:12107-12129 CACTGTCTTTGAGGAACTGAGGG + Intergenic
1203273571 22_KI270734v1_random:73283-73305 CACTGTCTTTGAGGAACTGAGGG - Intergenic
1203273764 22_KI270734v1_random:74213-74235 CACTGTGTTTCAGGAACTGAGGG - Intergenic
949356949 3:3190957-3190979 CACAGTGCTTGAGACACAGAGGG + Intergenic
949559594 3:5188824-5188846 CATTGAGTTTGAGGCAGAACGGG + Intronic
951811105 3:26701212-26701234 CCCTTTGTTTCAGGCTCAAAGGG + Intronic
953435044 3:42871429-42871451 CTTTGGGTGTGAGGCACAAAAGG + Intronic
953575830 3:44112473-44112495 CTCTGTGTCTGAGGGGCAAAAGG - Intergenic
954301512 3:49703073-49703095 CCCTGTGTTTGAGTCCCCAAGGG + Intronic
959668273 3:108945204-108945226 CACTGCCTTTGAGGAACCAATGG + Intronic
967689309 3:192455850-192455872 AATTGTGTTTGAGGGACCAATGG - Intronic
969079918 4:4610411-4610433 CACCGTGTGTGAGGCACAGAGGG - Intergenic
971004962 4:22362850-22362872 CACTAGGTTGGAGGCACAGAAGG + Intronic
972943776 4:44228525-44228547 ACTTGTGTTTGAGGAACAAATGG - Intronic
977711932 4:100136128-100136150 CACAGTCTTTGAGTAACAAAAGG + Intergenic
977921870 4:102654011-102654033 CACTTTGCCTGAGGCCCAAAAGG + Intronic
978765661 4:112402542-112402564 AATTGTGTTTAAGGCACAAAGGG - Intronic
982070726 4:151692281-151692303 CACTGCCTTTGAGGAAGAAAAGG + Intronic
983197096 4:164818946-164818968 TACTGTTTTTGAGGCAGAATTGG + Intergenic
984221711 4:176986103-176986125 TACTTTTTTTGAGGCACAGATGG + Intergenic
984304171 4:177965609-177965631 CACAGTGTGTGAGGAAGAAATGG - Intronic
987575437 5:19722382-19722404 CACTGTGTATAAGACACTAAAGG - Intronic
987708245 5:21481915-21481937 CACTGTGTTTGAGGAACTGAGGG + Intergenic
988088603 5:26504864-26504886 CACAGTGTTTGAGGTACTGATGG - Intergenic
988300499 5:29419245-29419267 CAGTGTTTTGGAGGCAAAAATGG - Intergenic
988751363 5:34192224-34192246 CACTGTGTTTGAGGAACTGAGGG - Intergenic
988751535 5:34193040-34193062 CACTGTGTTTGAGGAACTGAGGG - Intergenic
988953215 5:36286459-36286481 GACTGTGTTGGAGGGACAAAAGG - Intronic
991736328 5:69633338-69633360 CACTGTGTTTGAGGAACTGTGGG - Intergenic
991736677 5:69634967-69634989 CACTGTGTTTGAGGAACTGTGGG - Intergenic
991736849 5:69635783-69635805 CACTGTGTTTGAGGAACTGTGGG - Intergenic
991758214 5:69899360-69899382 CACTGTGTTTGAGGAACTGTGGG + Intergenic
991758388 5:69900176-69900198 CACTGTGTTTGAGGAACTGTGGG + Intergenic
991758565 5:69900992-69901014 CACTGTGTTTGAGGAACTGTGGG + Intergenic
991758736 5:69901805-69901827 CACTGTGTTTGAGGAACTGAGGG + Intergenic
991812824 5:70488977-70488999 CACTGTGTTTGAGGAACTGTGGG - Intergenic
991813174 5:70490612-70490634 CACTGTGTTTGAGGAACTGTGGG - Intergenic
991815782 5:70509454-70509476 CACTGTGTTTGAGGAACTGTGGG - Intergenic
991816306 5:70511893-70511915 CACTGTGTTTGAGGAACTGTGGG - Intergenic
991837617 5:70775242-70775264 CACTGTGTTTGAGGAACTGTGGG + Intergenic
991837794 5:70776058-70776080 CACTGTGTTTGAGGAACTGTGGG + Intergenic
991837965 5:70776871-70776893 CACTGTGTTTGAGGAACTGAGGG + Intergenic
992681452 5:79157327-79157349 TGCTGTGTTTTAGCCACAAAAGG + Intronic
992827499 5:80565209-80565231 CAGTGTTTTTGATGTACAAATGG - Intronic
994420317 5:99522929-99522951 CACTGTGTTTGAGGAACTGAGGG + Intergenic
994420486 5:99523748-99523770 CACTGTGTTTGAGGAACTGAGGG + Intergenic
994486554 5:100390566-100390588 CACTGTGTTTGAGGAACTGAGGG - Intergenic
994486723 5:100391385-100391407 CACTGTGTTTGAGGAACTGAGGG - Intergenic
994486892 5:100392204-100392226 CACTGTGTTTGAGGAACTGAGGG - Intergenic
997886110 5:137631256-137631278 CATTGTCTTAGAGGCCCAAAGGG - Intronic
998739733 5:145187021-145187043 CACTGTGCTGGAGAGACAAAGGG - Intergenic
1001707579 5:173752753-173752775 CACTGTGAGTGAGGCAGACAAGG + Intergenic
1001874131 5:175184647-175184669 CACTGAGTTTGAGCCTCAATGGG - Intergenic
1005549339 6:26898052-26898074 CACTGTCTTTGAGGAACCGAGGG - Intergenic
1005549689 6:26899689-26899711 CACTGTCTTTGAGGAACTGAGGG - Intergenic
1005899812 6:30207500-30207522 GAGTGTGTTTGAGGATCAAAAGG - Intronic
1006227519 6:32552757-32552779 CAATGTGTTTGTGGCACAAGGGG + Intergenic
1006896555 6:37475081-37475103 CACTGGGTTTGAGGTTCAAGGGG + Intronic
1007236621 6:40395044-40395066 CACAGTGTTTGGGGCAGAAGAGG + Intronic
1009004958 6:57773866-57773888 CATTCTGTTGGAGGCTCAAATGG + Intergenic
1010118912 6:72350357-72350379 CACTTTGATTTAGGCACCAAGGG - Intronic
1011420938 6:87172328-87172350 CAGAATGGTTGAGGCACAAATGG + Intronic
1013161101 6:107545923-107545945 AACTGTTTTAGAGGCACAGATGG + Intronic
1013301210 6:108806286-108806308 CACTGTGTCTGAGGCAGAGGAGG - Intergenic
1013699606 6:112749292-112749314 CACTGTTATTGCTGCACAAAGGG + Intergenic
1016354857 6:143207558-143207580 CACTGTATTTATGACACAAATGG - Intronic
1022418653 7:30199552-30199574 CAATGTGTTTGTGCCAGAAATGG - Intergenic
1023620081 7:42062198-42062220 CACTGGATTTTAGGAACAAATGG - Intronic
1024127711 7:46317637-46317659 AACTGTGTTTGAGGCAAAGTTGG + Intergenic
1024139632 7:46448760-46448782 CACTGAGATTATGGCACAAACGG - Intergenic
1024251582 7:47509570-47509592 CACTGAATTTGATGCACAGACGG - Intronic
1026406329 7:70070158-70070180 CTCTCTCTTTTAGGCACAAATGG - Intronic
1030178719 7:106682229-106682251 TACTCACTTTGAGGCACAAATGG + Intergenic
1030616524 7:111743480-111743502 CAGTGTGTATGAGGCATAAAGGG + Intronic
1032446346 7:131987044-131987066 TATTGTATTTGAGGCACAATGGG + Intergenic
1033226474 7:139566949-139566971 CACTGGGTTTGAGGGAAGAACGG + Exonic
1035013321 7:155740232-155740254 CACAGTCTTTGAGACACAAAAGG - Intronic
1036583244 8:10098126-10098148 CAATGTGTTTGTAGTACAAAAGG - Intronic
1038003855 8:23413467-23413489 CACTGTGTATGAGGGGCATATGG - Intronic
1038259708 8:25982164-25982186 AACTGTTTTTGAAGCATAAATGG - Intronic
1040859461 8:51984182-51984204 CCCTGTGCTCCAGGCACAAAGGG + Intergenic
1041731652 8:61068937-61068959 CACTGTGGAAGAGGGACAAATGG - Intronic
1044103437 8:88170830-88170852 CACTGTGTCTGATGGAAAAATGG + Intronic
1044857616 8:96493051-96493073 AACTGTGTGTGAGGGAGAAATGG + Intergenic
1045562013 8:103272895-103272917 TACTTTCTTTGAAGCACAAAAGG + Intergenic
1048212079 8:132463336-132463358 CACTCTAGTTGAGCCACAAATGG + Intronic
1048359855 8:133688478-133688500 CACTGTGTTTGGGGAAGGAAGGG - Intergenic
1048903485 8:139063486-139063508 CACTGAATTTGAGGGCCAAAAGG - Intergenic
1049391518 8:142373948-142373970 CACTGTGTGTGTGGAGCAAAGGG + Intronic
1051192838 9:14533434-14533456 CTCTGTGTGTGAGGCAGAAGAGG + Intergenic
1055392493 9:75838025-75838047 GACTGAGTTTGAAGGACAAAGGG - Intergenic
1055779267 9:79801591-79801613 CACTGTGATTCAGCCACAGAGGG - Intergenic
1056500422 9:87203281-87203303 CACAGTGGCTGAAGCACAAACGG - Intergenic
1058069906 9:100591387-100591409 CAGTGTGGCTGAGGAACAAAGGG + Intergenic
1059103914 9:111495039-111495061 CATTAAGTTTGAAGCACAAATGG - Intergenic
1059551759 9:115236178-115236200 GACGGTGTTGGAGGCAAAAATGG - Intronic
1059762556 9:117352525-117352547 CACAGGGATTGAGGCACCAAGGG + Intronic
1060468923 9:123930978-123931000 TACTGTGTCTGATGCAGAAAGGG - Intergenic
1061279515 9:129589272-129589294 CACTGTTTTTCAGCCACACAGGG - Intergenic
1186973619 X:14875662-14875684 CATTCTGTTTGAGGAACACAAGG - Intronic
1187659902 X:21532587-21532609 TACTGTATTTAAGGCAAAAATGG + Intronic
1187679376 X:21751585-21751607 CCCTGTGTTTGAGGCACTCAAGG - Intronic
1190361196 X:49650221-49650243 CAGTTAGTTTGAGGCAAAAAAGG + Intergenic
1190954374 X:55178009-55178031 AAGTGTGTTTGAGGGACAACTGG - Intronic
1194247934 X:91538080-91538102 AAGTGTGAATGAGGCACAAAGGG - Intergenic
1194722601 X:97357641-97357663 CACTGTGTTTGACCCACAGTAGG - Intronic
1195458153 X:105092859-105092881 CATTGTTTTTCAGGCACACAGGG - Intronic
1196047222 X:111269080-111269102 CACTGTTTTGGGGTCACAAAGGG + Intronic
1196108889 X:111925286-111925308 TTCTGTGTCTGAGGCACAGAAGG + Intronic
1196371433 X:114983742-114983764 TAGAGTGTTTAAGGCACAAATGG + Intergenic
1196915252 X:120527682-120527704 AACTTTGTTTCATGCACAAAAGG - Intronic
1197162236 X:123337004-123337026 CACTGAGCTTGAGACTCAAAAGG + Intronic
1197772593 X:130098710-130098732 AAATGTGTTTGAATCACAAAGGG + Intronic
1199297308 X:146173906-146173928 AAATGTTTTTGAGACACAAAGGG - Intergenic
1200566950 Y:4779609-4779631 AAGTGTGAATGAGGCACAAAGGG - Intergenic
1201437702 Y:13977362-13977384 CACTGTGCTTGAGGGAAATAAGG + Intergenic