ID: 919344543

View in Genome Browser
Species Human (GRCh38)
Location 1:196358850-196358872
Sequence TGTACTCGAAATTTGAAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 161}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919344543_919344545 -2 Left 919344543 1:196358850-196358872 CCATATTTCAAATTTCGAGTACA 0: 1
1: 0
2: 0
3: 8
4: 161
Right 919344545 1:196358871-196358893 CAAGATATAAGGACATTAAATGG 0: 1
1: 0
2: 2
3: 27
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919344543 Original CRISPR TGTACTCGAAATTTGAAATA TGG (reversed) Intronic
905255361 1:36678241-36678263 TCTACTGGGAATTTGAAATCTGG + Intergenic
906953340 1:50351678-50351700 TTTCCTGGAAATTTGAAATTGGG - Intergenic
907595403 1:55715133-55715155 TGCACTTGAAATTCCAAATAAGG - Intergenic
908148656 1:61275896-61275918 TGTAGTTAAAATTTTAAATATGG + Intronic
909334238 1:74452551-74452573 TGTATTTGACATGTGAAATAAGG - Intronic
909713262 1:78676068-78676090 TCTACACAAAATTTGAAATTAGG + Intergenic
909900695 1:81131097-81131119 TGTATTTTAAATTTTAAATATGG - Intergenic
910786988 1:91010098-91010120 TGGATTAGAAATTGGAAATAAGG - Intronic
911593216 1:99771475-99771497 TTTACTCAAAAATAGAAATAAGG + Intergenic
911725518 1:101237788-101237810 TGCAATCGAAATTAGAAATGTGG + Intronic
913428713 1:118764843-118764865 TTTATTCAAAATTTGAAATCAGG + Intergenic
914792629 1:150891997-150892019 TATACTAGAAATTTGTGATAAGG + Intergenic
917188773 1:172391147-172391169 TATTCTAGAAATTTCAAATAAGG - Intronic
917253209 1:173085285-173085307 TGTACTTGAAATTTGCTAAAAGG + Intergenic
918441785 1:184575169-184575191 TGTTCTTCAAAATTGAAATACGG - Intronic
919344543 1:196358850-196358872 TGTACTCGAAATTTGAAATATGG - Intronic
921324119 1:213973661-213973683 TGTACTAGAAAGGTGGAATAAGG - Intergenic
923636666 1:235704840-235704862 TGTACTCAAAAAATCAAATAAGG + Intronic
1063106005 10:2992951-2992973 TTTTGTCGAAATTTGAAATTTGG - Intergenic
1064169473 10:13017560-13017582 TGGACTTGAAATTTAAAAAAAGG - Intronic
1064750746 10:18526043-18526065 TGTGCTCAAATTTTAAAATAAGG + Intronic
1065105788 10:22383077-22383099 TTTACTTAAAATTTGAAATGAGG + Intronic
1067534757 10:47100926-47100948 TGGACTTGAAATTTGAACTCAGG - Intergenic
1067912359 10:50359011-50359033 TGTAATAGCAATTTAAAATAAGG - Intronic
1068343486 10:55739831-55739853 TGTAGTTGAAGTTTGAAATTTGG + Intergenic
1069333536 10:67321702-67321724 TGGACTCGAGATTTAAAATTTGG - Intronic
1071864448 10:89711454-89711476 TGTACCCAAAATTTAAAATAGGG + Intronic
1073271746 10:102270517-102270539 TTGACTCTAAATGTGAAATATGG - Intronic
1074168494 10:110908405-110908427 TGTAATAGAAAGTAGAAATAAGG - Intronic
1086820961 11:91435588-91435610 TGTACTTTTTATTTGAAATACGG - Intergenic
1087540896 11:99518139-99518161 TATACTGGAAATTTGAAACCTGG - Intronic
1088444866 11:109915189-109915211 TTTACTTGAAATTTGTAACAGGG + Intergenic
1088568211 11:111195700-111195722 TGTAACTGAATTTTGAAATAGGG + Intergenic
1090503436 11:127284252-127284274 TGTTCTCAGCATTTGAAATAGGG - Intergenic
1093452322 12:19330305-19330327 TAAACTAGAAATTTAAAATATGG + Intronic
1098037103 12:66315420-66315442 TGTATTAGAAATTTAAAAAATGG + Intronic
1098281134 12:68863993-68864015 TGTATTGGTATTTTGAAATATGG + Intronic
1099014844 12:77331623-77331645 TTTTCTCGAAAGTTGAAATCAGG + Intergenic
1099135715 12:78897739-78897761 TGTACTGGTAATTTAAAATTTGG + Intronic
1099543477 12:83945321-83945343 TGTACTGTAAATTTTACATATGG + Intergenic
1099580505 12:84440703-84440725 GGTACTCAAAGTTTGAAATAAGG - Intergenic
1103256213 12:119543651-119543673 TGCACTCCCAATTCGAAATATGG - Intergenic
1106655474 13:31741233-31741255 GGTACTAGGAGTTTGAAATATGG - Intronic
1106998682 13:35519251-35519273 TGGACTAGAATTTTGAAATTTGG - Intronic
1111804294 13:93020445-93020467 TTTACTAGAGATATGAAATATGG - Intergenic
1112707836 13:102091962-102091984 TTTATTGGACATTTGAAATAAGG + Intronic
1115010388 14:28538562-28538584 TGTACTCAAATTTTGAATAAAGG - Intergenic
1116673257 14:47871345-47871367 TTTCCTCAAAATTTAAAATAGGG - Intergenic
1117103045 14:52370102-52370124 TGTAATGCAAATTTGGAATACGG - Intergenic
1126519474 15:49575397-49575419 AGTACTAGGCATTTGAAATACGG + Intronic
1128069735 15:64787445-64787467 TGCACTGGAAATATAAAATAAGG - Intergenic
1131536631 15:93242453-93242475 TGGACTCAAGATTTGAAATTCGG + Intergenic
1134421378 16:14093386-14093408 TGTACTGCAAATTTAAAAAAAGG - Intronic
1137068425 16:35875514-35875536 TTTATTCAAATTTTGAAATAAGG + Intergenic
1137335846 16:47547869-47547891 TGTACTTGACATTTCAAATGAGG - Intronic
1138696029 16:58814379-58814401 TGTGCTCCAACTTTGAAAAATGG + Intergenic
1140417957 16:74790325-74790347 TGTACTTGAATTTAGTAATAAGG - Intergenic
1144530254 17:16031622-16031644 TGCACTGGAAATTTACAATATGG + Exonic
1156100128 18:33583852-33583874 TGCACTGGAAAAGTGAAATATGG + Intronic
1158540539 18:58349543-58349565 TGTACTGGAAATTTCAAACGTGG - Exonic
1159145291 18:64446217-64446239 TTTACTGAAAATTTGCAATAAGG - Intergenic
1162005460 19:7775635-7775657 TGTACTTGTATTTGGAAATAGGG + Intergenic
1163912368 19:20208125-20208147 TTTACTAGTAATTTTAAATAGGG + Intergenic
1164986691 19:32653574-32653596 TGAAATTGAAATTTGAAATCTGG + Intronic
1165676646 19:37730718-37730740 TGTACTTGATAATTGAAAAATGG - Intergenic
1166038413 19:40186934-40186956 TATACTTGAAATTTGTTATAAGG + Intergenic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
928297578 2:30097817-30097839 TGTACTCTAAATTGCGAATAAGG - Intergenic
930577457 2:53168860-53168882 TGTACTCAAAGTTTGAATGATGG - Intergenic
930745497 2:54878965-54878987 AGTACACTACATTTGAAATAGGG + Intronic
931005419 2:57845708-57845730 TATATTTGAAATTTGTAATAAGG + Intergenic
933681478 2:85105528-85105550 TGTAGTAGAAATTTGTAATAAGG + Intergenic
939513644 2:143139222-143139244 TGTAATCGAAATTGGAAGGAAGG - Intronic
939723636 2:145686717-145686739 TGTACTGTAAATATGACATATGG + Intergenic
939779381 2:146426386-146426408 TGTACTAGAAATCTGGAAGAAGG + Intergenic
940822149 2:158367612-158367634 TGTACTTCAAATTTTAATTATGG + Intronic
941253555 2:163198733-163198755 TATAAACTAAATTTGAAATAAGG + Intergenic
941573963 2:167207208-167207230 TGTACAAGAAATTTCAAATTTGG - Intronic
942326981 2:174784185-174784207 TCTGCTTGAAATTTGTAATAAGG + Intergenic
942540046 2:177006817-177006839 TGGACTCTAATTTTGAAAGAAGG + Intergenic
942768708 2:179488453-179488475 TGAAGTCCAAATTAGAAATAAGG - Intronic
946379867 2:219339885-219339907 TGTTATAGAAATGTGAAATAGGG + Intergenic
1172869598 20:38127657-38127679 TGTACTCAATCTTTGAAATGTGG - Exonic
1177339970 21:19785697-19785719 TGAACTCTAAATTTGAAACATGG + Intergenic
1177456017 21:21341020-21341042 TGTACTGTAAATTTGTAATATGG - Intronic
1177483646 21:21726652-21726674 TGTACTCTAAATTTCACCTAAGG + Intergenic
1178227356 21:30737870-30737892 TGATATCAAAATTTGAAATAAGG - Intergenic
1180375551 22:12089633-12089655 TTTGTTGGAAATTTGAAATAAGG - Intergenic
949129245 3:481423-481445 TTTACACGTCATTTGAAATATGG + Intergenic
951593416 3:24291175-24291197 TGTACTTGAAATTTGTAATTTGG + Intronic
955541199 3:59978333-59978355 CGTACTTTAAATTTTAAATAAGG - Intronic
957190947 3:77009345-77009367 TTTACTCTAAATTTAAATTATGG - Intronic
962585425 3:136838399-136838421 TTTATTCAAAATTTGACATATGG + Intronic
964025738 3:152071686-152071708 TGTTCTGGAAATTTGCCATAAGG + Intergenic
964060854 3:152520917-152520939 TGTACTTGAAATCTCAAAAATGG + Intergenic
965498740 3:169431536-169431558 TGAGCTCAAAGTTTGAAATAAGG - Intronic
966004583 3:174994066-174994088 TGTGATCGAATTTGGAAATAGGG - Intronic
966137740 3:176719237-176719259 GATACTTGAAATTTGGAATAAGG + Intergenic
966811626 3:183851119-183851141 TGTATTTGAGATTTGAGATAGGG - Intronic
970649904 4:18165926-18165948 TGTAATAGAATTTGGAAATAGGG - Intergenic
971985109 4:33811860-33811882 TGTACTAGAAATTTGTAGTGTGG - Intergenic
973787936 4:54351617-54351639 AGTACTCAAAATTTTAATTAAGG - Intergenic
974569910 4:63631233-63631255 TGTTATAGATATTTGAAATATGG - Intergenic
976425365 4:84896981-84897003 TTTACTCAAAACTTGAAATCTGG + Exonic
976767359 4:88611061-88611083 TGTGATCTAAATTTGGAATAAGG + Intronic
977285293 4:95098492-95098514 TGTACTCCACATTTGAGAAAAGG - Intronic
980837855 4:138219123-138219145 TTTACTTGAAATGAGAAATAAGG - Intronic
981263419 4:142751049-142751071 TGTACTCAAAATTTGCTATTTGG - Intronic
981966252 4:150607592-150607614 TGTGCTAGAGATTTAAAATAGGG + Intronic
984036272 4:174672127-174672149 AGTCCTTGAAATTTCAAATATGG - Intronic
985339707 4:188936619-188936641 TGTAATTGAAAATAGAAATAAGG + Intergenic
1202757150 4_GL000008v2_random:75075-75097 TTTGTTGGAAATTTGAAATAAGG - Intergenic
988293614 5:29324821-29324843 TGTAATCTTAATTTGAAAGAGGG + Intergenic
991051175 5:62273970-62273992 TGCACTGGGAATTTGAAATTAGG + Intergenic
991263104 5:64687793-64687815 TGGGCTGGAAATTTGAAGTAAGG + Intergenic
991541265 5:67731672-67731694 TGTAGCCAAAATTTGAAATCTGG + Intergenic
992498152 5:77313447-77313469 TGTACTCCAATTTTGAATAAAGG + Intronic
993254142 5:85565936-85565958 AGTATTCTGAATTTGAAATATGG - Intergenic
995012353 5:107271526-107271548 TGGAATCTACATTTGAAATAAGG - Intergenic
1003325937 6:5090807-5090829 TGTGCTAGAAAGCTGAAATATGG - Intergenic
1003895948 6:10607852-10607874 TTTACTCTAATTTTGAGATAGGG + Intronic
1004038573 6:11950661-11950683 TTTACTTGAAATATCAAATAAGG - Intergenic
1006563649 6:34935517-34935539 TGTACTTGAAATATGAGAAAGGG + Intronic
1007022888 6:38540080-38540102 TGTACTCCAAATTTTAAAATGGG + Intronic
1008928068 6:56908385-56908407 TATAATTGAAATTTAAAATATGG + Intronic
1009669792 6:66732219-66732241 TGGCCTCAAAATTTTAAATAAGG - Intergenic
1010574498 6:77514233-77514255 TTTTCTAGAAATTTGATATAAGG - Intergenic
1010914134 6:81594932-81594954 TCTGCTGGTAATTTGAAATAAGG - Intronic
1011463456 6:87630685-87630707 TGGAGTCAAAATTTTAAATAAGG + Intronic
1012072151 6:94636581-94636603 TGTACTCAAAATTTTAATTGGGG + Intergenic
1012325856 6:97916364-97916386 TGCACTCGAGGTTTGAAATCAGG - Intergenic
1012391765 6:98749073-98749095 TGGATTTGAAACTTGAAATATGG + Intergenic
1012586974 6:100935267-100935289 TGTACATGAAATATGAAGTAAGG - Intergenic
1015464124 6:133528827-133528849 TGTACTTGAAATATAAAAAATGG - Exonic
1016609962 6:145977743-145977765 TGTACTTGATCTTTGTAATATGG + Intergenic
1017202050 6:151765156-151765178 TGTACTAAACATTTGAAATGTGG + Intronic
1018301518 6:162407766-162407788 ATTACTCAAAATGTGAAATAAGG + Intronic
1020700931 7:11482289-11482311 TGTACTCTTAAGTTGTAATAAGG + Intronic
1023467960 7:40478699-40478721 TGTACTTGAAATTTGCCAAAAGG - Intronic
1027955620 7:84875550-84875572 CAAACTTGAAATTTGAAATATGG + Intergenic
1028658833 7:93243136-93243158 TATACTGGAAATTTGGAATTTGG + Intronic
1030354856 7:108530650-108530672 TGTACTGGAAATGTAATATAAGG + Intronic
1030384743 7:108855059-108855081 TGTGATCGTAATTGGAAATAGGG + Intergenic
1030942650 7:115673476-115673498 TGTATTTGAAATTAGAAAAATGG + Intergenic
1031007754 7:116493781-116493803 TATACTGGAAATATGCAATAAGG + Intronic
1031209738 7:118807490-118807512 TGTACTCCAAGTTTCAAAAAAGG - Intergenic
1034225947 7:149482110-149482132 TGTACACGGTTTTTGAAATACGG + Intronic
1039098670 8:33915713-33915735 TGGACTCTAATTTTAAAATAGGG - Intergenic
1043082315 8:75782353-75782375 GGTAGGTGAAATTTGAAATAAGG - Intergenic
1043184791 8:77133870-77133892 TGTCCTTGAAAGTTGAGATATGG - Intergenic
1045974591 8:108116883-108116905 TGTACATGAAATTTGAAAGAAGG - Intergenic
1046107769 8:109687104-109687126 TGGACTCTAATTTTGAACTATGG + Intronic
1046539293 8:115558038-115558060 TGTCCTCGTAATTAGAAATCTGG - Intronic
1050183987 9:2951902-2951924 TGTACTCTGAATTTGTAAGAGGG - Intergenic
1050631043 9:7559070-7559092 TCTACTCGAAATTTGATAGGAGG + Intergenic
1050666297 9:7940299-7940321 TGTACTCAAAATCTGGATTAAGG + Intergenic
1051308672 9:15745100-15745122 TATACTGGTAATTTGAAACAGGG - Intronic
1053402784 9:37841823-37841845 TTTATTTGAAATTGGAAATAGGG - Intronic
1054853711 9:69875139-69875161 TGCTCCCCAAATTTGAAATAAGG - Intronic
1055003271 9:71478015-71478037 CATACTCGAAATTCCAAATATGG - Intergenic
1055122975 9:72684598-72684620 TGGACTGGAAATATGAATTAGGG - Intronic
1057504676 9:95623452-95623474 TTTACTCCAATTTTGAAAGAAGG + Intergenic
1062671697 9:137714148-137714170 TGTACTAGAGATTCGAAGTAGGG - Intronic
1203537940 Un_KI270743v1:59935-59957 TTTGTTGGAAATTTGAAATAAGG - Intergenic
1187071221 X:15890535-15890557 TGTACTGGAAATTTGCCAAAAGG + Intergenic
1187116312 X:16355424-16355446 TCTACTAGACATTTAAAATATGG - Intergenic
1196544924 X:116950728-116950750 TGAACTGGTAATTTGAAATAGGG - Intergenic
1200945164 Y:8828140-8828162 TGTTCTAGATATTAGAAATAGGG + Intergenic
1201954438 Y:19607330-19607352 TGTAATGGAAAATAGAAATAGGG + Intergenic