ID: 919349293

View in Genome Browser
Species Human (GRCh38)
Location 1:196428859-196428881
Sequence CTGCCCACACATGGGCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 276}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919349288_919349293 -3 Left 919349288 1:196428839-196428861 CCCTATAGCCTGCTTCTGATCTG 0: 1
1: 0
2: 0
3: 10
4: 107
Right 919349293 1:196428859-196428881 CTGCCCACACATGGGCAGCCAGG 0: 1
1: 0
2: 2
3: 25
4: 276
919349289_919349293 -4 Left 919349289 1:196428840-196428862 CCTATAGCCTGCTTCTGATCTGC 0: 1
1: 0
2: 2
3: 8
4: 120
Right 919349293 1:196428859-196428881 CTGCCCACACATGGGCAGCCAGG 0: 1
1: 0
2: 2
3: 25
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919349293 Original CRISPR CTGCCCACACATGGGCAGCC AGG Intronic
900132432 1:1092779-1092801 AGGCTCACACCTGGGCAGCCTGG - Intronic
900187104 1:1337691-1337713 CGTCTCACACAGGGGCAGCCTGG - Intronic
900252973 1:1681046-1681068 CAGCCAACTCAAGGGCAGCCAGG + Intronic
900347495 1:2216611-2216633 CTGCCCAGCCTTGGACAGCCTGG - Intergenic
900463442 1:2812248-2812270 CTGGGCACACATGGGCACCAAGG - Intergenic
900997047 1:6128400-6128422 CTGCCCTCACTTGGGCGTCCTGG - Intronic
901446963 1:9314415-9314437 ATGCTCACAAGTGGGCAGCCAGG - Intronic
901641650 1:10695644-10695666 CTGCCAGCCCATGGCCAGCCAGG + Intronic
904585869 1:31580324-31580346 CTGCCCACACAGGTCCAGGCAGG - Intronic
905233643 1:36530597-36530619 CTGCCCACACCTCTGCAACCAGG + Intergenic
905900253 1:41576674-41576696 CTGCCCCCACAAGGACAGCATGG + Intronic
907051402 1:51331669-51331691 CTGCTCACAAATGGGCAGGATGG - Intronic
907314709 1:53560902-53560924 CTGCCCACAGCCAGGCAGCCAGG + Intronic
907414258 1:54303325-54303347 CTGCCCGAACAAGGGCAGCGAGG - Intronic
909064751 1:70921759-70921781 CTGCCATCACAATGGCAGCCCGG + Intronic
910771210 1:90834625-90834647 CTGCCCGCACACACGCAGCCAGG - Intergenic
912524788 1:110273582-110273604 CTGCCCACTGATGGCCACCCTGG + Intronic
913345433 1:117804814-117804836 CTGACCTCACATGGGCCACCTGG - Intergenic
913372617 1:118117553-118117575 CTGCCCTGACATGGGGAGACAGG + Intronic
916875412 1:168963499-168963521 CTGACCACAGACTGGCAGCCAGG - Intergenic
917979572 1:180260608-180260630 CTGCCCACACCTGGGCCAGCCGG + Intronic
918067131 1:181109081-181109103 ATCCCCATACTTGGGCAGCCTGG + Intergenic
919349293 1:196428859-196428881 CTGCCCACACATGGGCAGCCAGG + Intronic
920388757 1:205585942-205585964 CTCCCCACACCTGCCCAGCCTGG + Intronic
921766938 1:218983413-218983435 CTGGGCAGCCATGGGCAGCCCGG + Intergenic
922473617 1:225891070-225891092 GTGCCCACACAGGGGGTGCCTGG - Intronic
922704142 1:227780160-227780182 CTGCCCACAGTGGGGCAGCTGGG - Intronic
923220030 1:231884487-231884509 ATGCCCATCCATGGGCAGACTGG - Intronic
923333724 1:232949310-232949332 CTGCCCACACATGGACCTCTTGG - Intergenic
923716417 1:236428604-236428626 CATCCCAGACATGGGCGGCCGGG + Intronic
924201431 1:241663361-241663383 GTGCTCACATATGGGCACCCCGG + Intronic
924904302 1:248434961-248434983 CTGCTCACACATGCGCACCTGGG - Intergenic
924923589 1:248657085-248657107 CTGCTCACACATGCGCACCTGGG + Intergenic
1063067323 10:2623304-2623326 CTCCCCACACCTGGGCTGTCAGG + Intergenic
1063102053 10:2958867-2958889 GTGCCCACACAGGGGCGGCCTGG + Intergenic
1063148490 10:3317821-3317843 CTGCCCACGCAGAGGCTGCCGGG - Intergenic
1063148508 10:3317889-3317911 CTGCCCACGCAGAGGCTGCCGGG - Intergenic
1063148526 10:3317957-3317979 CTGCCCACGCAGAGGCTGCCGGG - Intergenic
1063148583 10:3318161-3318183 CTGCCCACACAGAGGCTGCCGGG - Intergenic
1063148617 10:3318298-3318320 CTGCCCACACAGAGGCTGCAGGG - Intergenic
1063148653 10:3318435-3318457 CTGCCCACACAGAGGCTGCCGGG - Intergenic
1063148671 10:3318503-3318525 CTGCCCACACAGAGGCTGCCGGG - Intergenic
1063148689 10:3318571-3318593 CTGCCCACACAGAGGCTGCAGGG - Intergenic
1063436349 10:6035281-6035303 CTGCCCACACAGGGAGACCCAGG - Intronic
1065837142 10:29668940-29668962 CTCAGCACACATGGGCAACCAGG - Intronic
1068734306 10:60394546-60394568 GTGACCTCACATGGGCAGACAGG + Intronic
1070438363 10:76415742-76415764 CTCCCCACACTTTGTCAGCCTGG + Intronic
1070548428 10:77470944-77470966 CTGCCCTCAGAGAGGCAGCCCGG + Intronic
1070570894 10:77638552-77638574 CTGCCCACCCCTGCCCAGCCCGG - Intronic
1070637403 10:78140287-78140309 CTGCTCACACATGTTCATCCTGG - Intergenic
1070781911 10:79142638-79142660 CTGCCCACACTTGGCCACACAGG + Intronic
1072718671 10:97767684-97767706 CTGCCCACAGCTGGACAGCCTGG - Exonic
1072753851 10:98003910-98003932 CTCCCCAGTCCTGGGCAGCCAGG - Intronic
1074146811 10:110724162-110724184 CTGCACACACACTGGCAGACGGG - Intronic
1075724075 10:124602889-124602911 CCGCCCACACATGTGCACACAGG + Intronic
1075846551 10:125549584-125549606 CTACCCACTCATGGTCAGCTAGG + Intergenic
1076542052 10:131220681-131220703 AGGCCCCCACGTGGGCAGCCAGG + Intronic
1076616324 10:131757423-131757445 CTACCCACACACAGGCAACCAGG + Intergenic
1077178608 11:1202561-1202583 CTGCCCACTCCTGGGATGCCGGG - Intergenic
1077233725 11:1470033-1470055 CAGCCCACACCAGTGCAGCCCGG + Exonic
1077506533 11:2932199-2932221 CAGCCCCCACATTGGCAACCAGG - Intergenic
1083228418 11:61299594-61299616 CTGCCAAGCCATGGGTAGCCTGG - Exonic
1083897027 11:65625099-65625121 CTTCTCACACGGGGGCAGCCCGG + Intronic
1083921450 11:65783089-65783111 CTGCCCACAACTGGGCTGCATGG - Intergenic
1084177844 11:67432833-67432855 CCGCACACACATGCGCACCCTGG - Exonic
1084675762 11:70633051-70633073 CTGGGCACAGATGGGCAACCTGG + Intronic
1085443418 11:76582851-76582873 CATCCCAGACATGGGCGGCCAGG + Intergenic
1090362612 11:126184144-126184166 CTGCCCACACCTGGGGGCCCAGG - Intergenic
1090415904 11:126540386-126540408 CTGCCCACACTGGCTCAGCCCGG - Intronic
1090906977 11:131084690-131084712 CATCCCAGACATGGGCGGCCAGG + Intergenic
1091105014 11:132910291-132910313 ATGCCCCCACAGGGGCAGGCCGG + Intronic
1091290268 11:134435600-134435622 CCACCCACTCATGGACAGCCAGG - Intergenic
1091404610 12:201486-201508 CTGCCCACACATGTCCAGTGGGG - Intronic
1091694289 12:2617534-2617556 CTGCCCCCACATGGGCACACTGG - Intronic
1091781890 12:3219090-3219112 CTTCCCACCCGTGGGCGGCCGGG + Intronic
1092937563 12:13378245-13378267 CTGTCCACACATAGGAAGGCAGG + Intronic
1093933569 12:24978231-24978253 ATAGCCACACATGGGCAGCACGG + Intergenic
1094074523 12:26458246-26458268 CCGCCCTCACCTGGACAGCCTGG - Intronic
1094204502 12:27826136-27826158 CTGCCCAAAGATGGGCAGAGTGG + Intergenic
1094287489 12:28811706-28811728 CTGCCCACAAGGGAGCAGCCTGG + Intergenic
1094370065 12:29728413-29728435 CTGCCCACATGTGGGAAGCCAGG + Intronic
1094404847 12:30106501-30106523 CTGCCCACATGTGGGAAGCCAGG + Intergenic
1095799377 12:46256495-46256517 CTGCCATCACAATGGCAGCCCGG - Intronic
1096777738 12:53974290-53974312 CTCCCCACTCCTCGGCAGCCCGG - Intronic
1097954627 12:65470779-65470801 TTGCCCACACATGGCCAGTGGGG + Intronic
1098228250 12:68346821-68346843 CTCCCCACACCAAGGCAGCCAGG + Intergenic
1104973596 12:132542287-132542309 CAGGCCACACATGCTCAGCCAGG + Intronic
1105278932 13:18952019-18952041 TGGCCCACACATGGGCACACGGG + Intergenic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1105729609 13:23199932-23199954 TTGCCCAAAAATGGGGAGCCTGG - Intronic
1106918492 13:34540283-34540305 CATCCCAGACATGGGCGGCCAGG - Intergenic
1107411689 13:40163906-40163928 CTGCCCACTCAAGGGGTGCCAGG - Intergenic
1108508595 13:51135153-51135175 CTGCCCACAGCTGCTCAGCCTGG + Intergenic
1108577168 13:51800491-51800513 CTGCCCACGCACAGGCAGGCTGG + Intronic
1109744895 13:66612674-66612696 CTGCCCACTGAAGGGGAGCCTGG + Intronic
1111542708 13:89689618-89689640 CTGCCCACCTATGGTCAGGCTGG - Intergenic
1113216459 13:108046362-108046384 CTGCTCACAGGTGGGCAACCAGG - Intergenic
1113910489 13:113839061-113839083 CTGCAAGCACATGGGCATCCAGG - Intronic
1117439278 14:55744990-55745012 GACACCACACATGGGCAGCCTGG - Intergenic
1118748427 14:68790233-68790255 CTGCCCACCCAGAAGCAGCCCGG - Exonic
1121719418 14:96098775-96098797 TTGCCCACACAGGAGCAGCCAGG + Intergenic
1121855793 14:97268994-97269016 CTGCCCACACATGTCCTACCAGG + Intergenic
1122119399 14:99543906-99543928 CAGCCCACAAATGGGCATGCAGG + Intronic
1122174139 14:99904673-99904695 CTGCCATCACAGTGGCAGCCTGG - Intronic
1122386218 14:101350083-101350105 CTGAGCAAACAGGGGCAGCCAGG - Intergenic
1123987673 15:25659407-25659429 CTGCCCTCTCCTGCGCAGCCGGG + Intergenic
1124190998 15:27576189-27576211 CTGTCCACTCATGGTCAACCTGG + Intergenic
1124215938 15:27807119-27807141 CTACCCATCCACGGGCAGCCTGG + Intronic
1125506996 15:40272780-40272802 CTGCTCACAGATGTCCAGCCTGG - Intronic
1125597239 15:40894826-40894848 ATGCCCACGCTAGGGCAGCCGGG - Exonic
1128634861 15:69296720-69296742 CTGCCCAGACCTGGAAAGCCAGG - Intergenic
1128819968 15:70643011-70643033 CTTCCCAAACAAGGGCTGCCTGG - Intergenic
1129255105 15:74329988-74330010 CTGCCCTCACATGGCCAGGATGG + Intronic
1130094783 15:80847843-80847865 CTGCCCACCCAGGAGGAGCCAGG + Intronic
1131066067 15:89435762-89435784 CTGCCCCCTCCTAGGCAGCCAGG + Intergenic
1131360807 15:91789023-91789045 CTGTCCACACCCTGGCAGCCTGG + Intergenic
1131769822 15:95725030-95725052 ATGCCCAGTCATGGGCAGCATGG - Intergenic
1132132581 15:99296592-99296614 CTGACCACACATATACAGCCTGG - Intronic
1132592884 16:734004-734026 CTGCTCACCCAGAGGCAGCCAGG - Intronic
1132654754 16:1037101-1037123 CTGCCCACACACGGGGCTCCTGG - Intergenic
1132668277 16:1091608-1091630 CTGCCCCCACAACTGCAGCCAGG + Intronic
1134053455 16:11154090-11154112 CTGCACACACATGCGCAGACAGG + Intronic
1136021236 16:27441516-27441538 CTGCCCAGAGCAGGGCAGCCAGG + Intronic
1137025304 16:35468212-35468234 CTTCCCACACATAGATAGCCTGG - Intergenic
1137442363 16:48508093-48508115 GTGACCACACATGGGCAGTCAGG + Intergenic
1137546157 16:49405133-49405155 CTGGGCACAGATGGGCAGCAGGG - Intergenic
1139485908 16:67256465-67256487 CAGGCCACACATGGTCACCCTGG - Exonic
1140018601 16:71214611-71214633 GTGCTCACACATATGCAGCCTGG + Intronic
1141461167 16:84179588-84179610 CTGTCCACACAGGAGGAGCCAGG + Exonic
1142145322 16:88490652-88490674 CTTCCCACAACAGGGCAGCCGGG + Intronic
1142195792 16:88738793-88738815 CAGCCCACACCTGCCCAGCCAGG + Intronic
1142211140 16:88809113-88809135 CTGCCCCGACACAGGCAGCCTGG + Exonic
1142299304 16:89247367-89247389 CTGCCCGCTCATGCGCAGCTGGG - Intergenic
1142343256 16:89537755-89537777 CTGCCCAGACACTGGGAGCCTGG - Intronic
1142366526 16:89652824-89652846 CTGGCCACAGATGAGCAGCCAGG + Intronic
1143305255 17:5941451-5941473 GTGCCCACACAGGCACAGCCAGG - Intronic
1143325967 17:6098633-6098655 CTGACCACGCAGAGGCAGCCCGG - Intronic
1143497218 17:7319089-7319111 GTGCCCTCAAACGGGCAGCCTGG - Exonic
1143535309 17:7535237-7535259 TTGCTCACACCTGGGCAGACTGG + Intergenic
1144760944 17:17706942-17706964 CTGCTCACCCATGGGCACCTAGG - Intronic
1145746674 17:27325174-27325196 CTGAGCACACAGGGCCAGCCAGG + Intergenic
1146669068 17:34724370-34724392 CTCCCCAGCCAAGGGCAGCCTGG - Intergenic
1147399959 17:40174769-40174791 CTGCCCACCCAGAGGCAGGCTGG - Intergenic
1149294357 17:55248344-55248366 CTGTCCAGAGATAGGCAGCCTGG - Intergenic
1151559363 17:74862263-74862285 CTGTCCACACTAGGGCTGCCCGG - Intergenic
1151656894 17:75500352-75500374 CTGCCCTCAGGTGGGCAGTCGGG + Exonic
1151718953 17:75844947-75844969 CTGCCCCCACCTTGGCAGTCAGG + Intergenic
1152604672 17:81283103-81283125 CTGCCCTCCAATGGGCAGCCCGG + Intronic
1152797127 17:82314013-82314035 CTAGCTTCACATGGGCAGCCTGG - Intergenic
1154003425 18:10506156-10506178 CTTCCCAGACAGGGGCGGCCAGG + Intergenic
1157617719 18:48997058-48997080 CTGCCCTCCCCAGGGCAGCCAGG - Intergenic
1159886672 18:73914246-73914268 CTGCCTCCCCATGGGGAGCCTGG + Intergenic
1160242732 18:77134498-77134520 GTCCACACAGATGGGCAGCCAGG + Intergenic
1160509864 18:79447305-79447327 CTGCCCACTCAGGGCCAGCGAGG - Intronic
1160764962 19:803467-803489 CTGCTCCCACTTGGGCTGCCTGG - Intronic
1160802878 19:978527-978549 TTGGCCACACAGGGCCAGCCGGG + Intergenic
1161978569 19:7619254-7619276 CTGGCGAGACCTGGGCAGCCAGG + Intergenic
1162947409 19:14052231-14052253 CTGCCCACACCTGAGGAGCTGGG + Exonic
1163178629 19:15583484-15583506 GTGCCCACAGTTGGGCAGGCGGG + Intergenic
1163648975 19:18506108-18506130 CTGGGCACACATGGGCACCCAGG - Intronic
1165474066 19:36019363-36019385 GTGCCCACACACGGGCAGCAAGG + Intronic
1165826383 19:38708305-38708327 CTGCACGCAGATGGGCAGCCTGG + Intronic
1167039293 19:47013163-47013185 CTGCCCAGCCATGGCCATCCCGG + Intergenic
1167322384 19:48805290-48805312 CTGTCCCCACATGGGGACCCAGG - Intronic
1167587703 19:50384268-50384290 TTGCCCGCACTTGGGCAGGCGGG + Intronic
1167907762 19:52676431-52676453 CATCCCAGACATGGGCGGCCAGG - Intronic
1168119238 19:54242448-54242470 AGGGCCACACATGGGCAGCTGGG - Intronic
1168128606 19:54301923-54301945 CTGCACCCACATTGGGAGCCTGG + Intergenic
1168686817 19:58353890-58353912 TTGCCCTCACATGGGCTGTCTGG + Intergenic
925061125 2:890997-891019 CTGACCACACATGGAAAGCAGGG + Intergenic
925510647 2:4621811-4621833 CTGCCCACAGCTGGACAGGCTGG - Intergenic
925613217 2:5720793-5720815 CTGCCTTCACCTCGGCAGCCTGG + Intergenic
927853472 2:26513981-26514003 ATGGCCCCATATGGGCAGCCAGG + Intronic
931249058 2:60514309-60514331 CTGCCCAGAAATGGGTTGCCTGG - Intronic
932614505 2:73223393-73223415 CTCCCCAACCATGGGCTGCCTGG + Intronic
932734084 2:74242154-74242176 CTGCCCTCACAATGGAAGCCAGG - Intronic
937399268 2:121567514-121567536 CCTCCCACAGAAGGGCAGCCTGG + Intronic
938262604 2:129906294-129906316 TTGCCCTCACATGGGGACCCTGG - Intergenic
938307500 2:130265525-130265547 CTGCCCAGCCTTGGGGAGCCTGG - Intergenic
938447832 2:131391317-131391339 CTGCCCAGCCTTGGGGAGCCTGG + Intergenic
940823649 2:158385885-158385907 CTGCCAAAACAAGGGCATCCTGG + Intronic
940855008 2:158723039-158723061 CTCTCCACACCTGGGCAGGCAGG - Intergenic
941477547 2:165967924-165967946 CTGCACACATATGGGGACCCTGG - Intergenic
946475242 2:220000650-220000672 CTTCCCACACACAGACAGCCAGG - Intergenic
947606671 2:231490529-231490551 CTGCCCACAGATAGGGAGCCAGG + Intergenic
947732975 2:232441222-232441244 CTCCCCCAACATGGCCAGCCAGG - Intergenic
948656973 2:239482420-239482442 CTTCCCACCCATGGGAACCCTGG - Intergenic
948922591 2:241072707-241072729 CTGCCCACCACTGGGCATCCCGG - Intronic
949073434 2:242040392-242040414 CGGCCATCACATGGTCAGCCAGG - Intergenic
1169342946 20:4810134-4810156 CTGCCCACTCAGGACCAGCCTGG + Intronic
1169923391 20:10758446-10758468 TTCCCCACACATGGGCAGAGTGG - Intergenic
1170803587 20:19610843-19610865 CTGCCCTCACATGGCCAGGCTGG - Intronic
1171373522 20:24676513-24676535 CTCCTCACAGAGGGGCAGCCAGG - Intergenic
1174169392 20:48606746-48606768 CTGCCCAGGCCTGGACAGCCTGG - Intergenic
1175173050 20:57093147-57093169 CCTCCCACGCCTGGGCAGCCGGG - Intergenic
1175251869 20:57614857-57614879 CAGCCCAGACACAGGCAGCCGGG + Intronic
1175862422 20:62157394-62157416 CTGGCCACACCTGAGCAGCAGGG - Intronic
1175899697 20:62355125-62355147 CTGCTCACAGGTGGGCACCCAGG + Intronic
1175963273 20:62647750-62647772 CTGCCCACACACGGGGATACAGG + Intronic
1176001899 20:62836008-62836030 CTGCCCACCTCTGGGCAACCAGG + Intronic
1180612947 22:17109325-17109347 CTGCCCGCTGCTGGGCAGCCCGG + Exonic
1181047789 22:20223810-20223832 GTCCTCACACATGGGCAGCAGGG - Intergenic
1181286156 22:21753954-21753976 GTGCCCAGATATGGCCAGCCTGG + Intergenic
1181372617 22:22430165-22430187 CTGCCCACAGATGTGCTTCCTGG - Intergenic
1181429043 22:22866517-22866539 CTGCCAACTCATGAGCAGCTAGG - Intronic
1181473123 22:23152890-23152912 CTGCCCACCCATGGCCTGCGTGG + Intronic
1183989341 22:41587797-41587819 CTGACCGCACTTGGGGAGCCTGG - Intronic
1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG + Intronic
950305980 3:11915608-11915630 CTGCCCACCCCTGGGCAGGGAGG - Intergenic
954871472 3:53770632-53770654 GTGGCCACACAGGGGGAGCCTGG - Intronic
955345115 3:58155201-58155223 CTGCCCACCCATGGCTACCCTGG + Intronic
968551224 4:1224297-1224319 CAGCACACACATGGGCCGCACGG - Intronic
969484409 4:7464111-7464133 CTGAACACACCTGGTCAGCCTGG + Intronic
975351516 4:73352355-73352377 CTGACAACACATGGGCAGACTGG + Intergenic
977403764 4:96569586-96569608 ATGCCCAAACATGGACAGCTGGG + Intergenic
979284742 4:118909639-118909661 CTGCCCACGCTTGGGAAGGCTGG + Intronic
984006406 4:174314986-174315008 CTTCCACCACATGGCCAGCCCGG - Intronic
985643696 5:1075238-1075260 GTGCCCTCACAGGGGCAGCTGGG - Intronic
985977330 5:3430479-3430501 CTGCCCTCACAGGAGCAGCGAGG - Intergenic
987405194 5:17517821-17517843 CGGCCCAGACCTGGGCAGCACGG + Intergenic
987405639 5:17521255-17521277 CGGCCCAGACCTGGGCAGCACGG + Intergenic
987406087 5:17524689-17524711 CGGCCCAGACCTGGGCAGCACGG + Intergenic
987406534 5:17528123-17528145 CGGCCCAGACCTGGGCAGCACGG + Intergenic
987406910 5:17580814-17580836 CGGCCCAGACCTGGGCAGCACGG - Intergenic
987407163 5:17582848-17582870 CGGCCCAGACCTGGGCAGCACGG - Intergenic
987407612 5:17586282-17586304 CGGCCCAGACCTGGGCAGCACGG - Intergenic
987407863 5:17588047-17588069 CGGCCCAGACCTGGGCAGCACGG - Intergenic
987408310 5:17591484-17591506 CGGCCCAGACCTGGGCAGCACGG - Intergenic
987408758 5:17594918-17594940 CGGCCCAGACCTGGGCAGCACGG - Intergenic
987409330 5:17599083-17599105 CGGCCCAGACCTGGGCAGCACGG - Intergenic
987412785 5:17631542-17631564 CGGCCCAGACCTGGGCAGCACGG + Intergenic
988066501 5:26232790-26232812 CTGCCCACATGGAGGCAGCCGGG + Intergenic
992079179 5:73217946-73217968 ATGCCCACACCTGAGCAGCTGGG - Intergenic
998151456 5:139759782-139759804 CTCCCCACCCATGGGCACACAGG - Intergenic
999262126 5:150244766-150244788 CAGCCCACACATAGGCAGGACGG + Intronic
999376556 5:151090684-151090706 CTGCTCACATATAGGCAGCTAGG + Intronic
1000107394 5:158073179-158073201 CTTCCCAGTCATGGGCAGCCAGG + Intergenic
1001270748 5:170309825-170309847 CTAGCCCCACATGGCCAGCCAGG - Intergenic
1002101447 5:176860084-176860106 CTGCCCCCACACGCCCAGCCAGG + Intronic
1002271944 5:178078306-178078328 GTGCCCACAAATGGGATGCCAGG - Intergenic
1002280542 5:178127499-178127521 CTGCCCAAGCATGAGGAGCCTGG - Intergenic
1002779504 6:355405-355427 TTGCCCACACATGCACACCCTGG - Intergenic
1003274802 6:4640313-4640335 CTGCTCACACCTGGGAAGCTGGG + Intergenic
1007735857 6:43981786-43981808 GTGACCACCCATGGGCAGGCCGG + Intergenic
1008027385 6:46653307-46653329 CTGCCCACGCCTGGGCCTCCCGG + Intronic
1010278857 6:74000909-74000931 TTGCCCACACAAGTGCATCCAGG - Intergenic
1016684551 6:146866538-146866560 CTGCGCTGAAATGGGCAGCCTGG - Intergenic
1018475074 6:164132449-164132471 CTGTATGCACATGGGCAGCCAGG - Intergenic
1019186564 6:170223940-170223962 GAGCCCTCACCTGGGCAGCCGGG - Intergenic
1019269735 7:140202-140224 CTGGCCACTCCTGAGCAGCCTGG - Intergenic
1019275002 7:171541-171563 CTTCCCAGACAAGGGGAGCCGGG - Intergenic
1019342160 7:513424-513446 CTGCCCGCACCTGGGCACCGCGG + Intronic
1019374821 7:683772-683794 CTCCCCACGGAAGGGCAGCCTGG + Intronic
1020000015 7:4750247-4750269 CGTCCCACACCTGGGCAGCTAGG + Intronic
1020507865 7:9017108-9017130 CCGCCCACTATTGGGCAGCCAGG - Intergenic
1021094300 7:16517891-16517913 CTGGCCACACATGGTGACCCAGG + Intronic
1022542745 7:31153580-31153602 CTTCCCAGACGGGGGCAGCCAGG - Intergenic
1022557083 7:31308840-31308862 CTGCTCACACAGCGGCAGTCTGG + Intergenic
1023881172 7:44322591-44322613 CTGCTCCCACATGGGCCACCAGG + Intronic
1023938971 7:44758031-44758053 CTGCCCCAACATGGGTATCCTGG + Exonic
1023973084 7:45006180-45006202 CTGCCCACACATGGGCACAGGGG - Intronic
1024150786 7:46569468-46569490 CAGCCGGCAGATGGGCAGCCTGG - Intergenic
1024991208 7:55235629-55235651 CTGCACTCACGGGGGCAGCCTGG + Intronic
1026579920 7:71606743-71606765 CTGCCCACATATGTGCTGGCAGG + Intronic
1026806869 7:73434336-73434358 CTGCTCGCACATGGGCCGGCAGG - Exonic
1027359656 7:77394805-77394827 CTGCCTACACATGTACAGCTTGG - Intronic
1029083918 7:97996717-97996739 TTGTCCCCACAAGGGCAGCCAGG - Intergenic
1029734437 7:102457715-102457737 CTCCCGACACATGGACAGCACGG + Exonic
1029864445 7:103611664-103611686 CACCCCACACATGGACAACCAGG - Exonic
1030866842 7:114710565-114710587 CTGCCCACACAAAGGCAGGTGGG - Intergenic
1032794084 7:135263655-135263677 CTGCCCACAGCTTGGCAGGCTGG + Intergenic
1033103668 7:138499413-138499435 TTACCCACAGATGGGCAGCAAGG + Intronic
1035202904 7:157278393-157278415 CCACCCCCAGATGGGCAGCCTGG + Intergenic
1040079950 8:43275642-43275664 CTGCCCACTGCTGGGTAGCCCGG + Intergenic
1043195719 8:77288963-77288985 CTGCCCACACATGGCTACCAAGG - Intergenic
1048360954 8:133696859-133696881 CTGCCCACACTCCGGCAGCTGGG - Intergenic
1049015997 8:139920510-139920532 CTGCCTACACAGTGGCAGCCAGG + Intronic
1049546503 8:143234148-143234170 CTGCACACTCATGTGCACCCAGG - Intergenic
1049798157 8:144505778-144505800 CTGCCCTCCGCTGGGCAGCCGGG - Intronic
1052881450 9:33603116-33603138 CTGGCCCCACATGGGCAGCCTGG - Intergenic
1053197237 9:36128574-36128596 CTGCTCACACGTGGCCAGACTGG - Intergenic
1053466321 9:38311328-38311350 CTTTCCTCACATGGCCAGCCTGG + Intergenic
1053494868 9:38542729-38542751 CTGGCCCCACATGGGCAGCCTGG + Exonic
1056601433 9:88050196-88050218 CACCCCACACCTGGGCAGCAGGG - Intergenic
1058714959 9:107715222-107715244 CTGCCCACACTGCGGCAGTCAGG - Intergenic
1060292074 9:122313037-122313059 TTGCCCAAACATGGGCAAACTGG - Intronic
1061169796 9:128946007-128946029 CTGCACACAGAAGGGTAGCCTGG - Exonic
1061419274 9:130464442-130464464 CTGCCCACACCTGGGATGCCAGG - Intronic
1062039351 9:134396933-134396955 CAGCCCCCTCCTGGGCAGCCAGG - Intronic
1062200247 9:135299037-135299059 CTGTCCTCAGATGGCCAGCCTGG - Intergenic
1062276718 9:135734838-135734860 CTGCCCATACATGGTCACCCTGG - Intronic
1186435988 X:9543518-9543540 CAGCCCACCCATGGGAGGCCAGG + Intronic
1187028151 X:15457262-15457284 CTGCCCACATATGGTCAGTGAGG + Intronic
1187146078 X:16638649-16638671 CTCCCCACACTGGGGCTGCCAGG + Intronic
1187640042 X:21277334-21277356 CTGCCCTCACATGTGCATGCTGG - Intergenic
1191682612 X:63856700-63856722 CTGCCCACACATTGGCCCCAGGG - Intergenic
1192174532 X:68877710-68877732 CTACCCACACCGGGGCAGGCGGG - Intergenic
1192504893 X:71675785-71675807 CTTCCCAGACAGGGGCGGCCAGG - Intergenic
1192864687 X:75118207-75118229 CTGCCATCACAATGGCAGCCTGG + Intronic
1198039568 X:132836435-132836457 GTGCCCACAAATGGGAAGGCTGG + Intronic
1199971973 X:152867933-152867955 ATGCCAACAGGTGGGCAGCCAGG - Intronic
1199990995 X:152987774-152987796 CTCCCCACACATGTGCAGGGAGG + Intergenic
1200034082 X:153317248-153317270 CTCCCCACACATGTGCAGGGAGG + Intergenic
1200141561 X:153905277-153905299 CTCCCCACTCATTGGCAGCCTGG - Intronic