ID: 919349846

View in Genome Browser
Species Human (GRCh38)
Location 1:196435769-196435791
Sequence GAGACAGAATTGCCTGTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 1, 2: 2, 3: 27, 4: 369}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919349846 Original CRISPR GAGACAGAATTGCCTGTAAT AGG Intronic
901503204 1:9666796-9666818 GAGGCAGAATTGCCTGAACCCGG - Intronic
901783093 1:11607502-11607524 GAGACAGAATTGCTTGAACCCGG + Intergenic
902101344 1:13992480-13992502 GAGAGAGAATTTCCTGCAAATGG + Intergenic
902311068 1:15582170-15582192 GAGACAGAATTGCTTGAACCCGG + Intronic
903146306 1:21374787-21374809 GAGACAGAATTGCTTGAACTCGG - Intergenic
903416814 1:23189265-23189287 GAGGCAGAATTGCTTGAACTGGG - Intergenic
903475638 1:23617505-23617527 GTGACAGAATTTCCTGTATCAGG - Intronic
903951261 1:26997239-26997261 GAGAAAGAATTGCTTGAACTCGG + Intronic
904182212 1:28674054-28674076 GAGACAGAATTGCTTGAACTAGG + Intronic
904739932 1:32666450-32666472 GAGACAGAATTGCTTGAACCTGG - Intronic
905107392 1:35572673-35572695 GAGAGAGACTTGCCTGGGATGGG - Intergenic
905187334 1:36205920-36205942 GAGGCAGAATTGCTTGAACTCGG + Intergenic
907176177 1:52524707-52524729 GAGACAGAATTGCTTGAACCTGG + Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
907888533 1:58616559-58616581 CAAACTGAATTGCCTTTAATTGG - Intergenic
908851412 1:68380539-68380561 GAGACAGAAGTGTGTGTAAAGGG + Intergenic
910247118 1:85150671-85150693 GAGACAGAATTGCTTGAACCCGG + Intergenic
911867090 1:103042456-103042478 GAGACAGAAATGTTAGTAATAGG - Intronic
914829368 1:151159479-151159501 GAAACAGAACTGCCTGAAAAAGG + Exonic
915623634 1:157101067-157101089 GAGATAGACTTGCCTGATATAGG + Intergenic
916698292 1:167263421-167263443 GAGACAGAATTGCTTGAACCCGG + Intronic
918561580 1:185874489-185874511 AAGAGTGAATTGACTGTAATAGG + Intronic
918640894 1:186840067-186840089 GAGGCAGAATTGCTTGAACTTGG - Intronic
919349846 1:196435769-196435791 GAGACAGAATTGCCTGTAATAGG + Intronic
921733628 1:218601310-218601332 AAGAAAGAATTGCCAGTACTTGG + Intergenic
922497853 1:226074438-226074460 TAGACAGAATTGCTTGAACTCGG - Intergenic
922497936 1:226075069-226075091 GAGACAGAATTGCTTGAACCCGG - Intergenic
924016134 1:239725270-239725292 GAAACATAAATACCTGTAATTGG + Intronic
924092291 1:240513930-240513952 GAGACAGAAATGGCTTTAAGAGG + Intronic
1063130166 10:3171535-3171557 GAGACAGAATTGCTTGAACCCGG - Intronic
1063419476 10:5900099-5900121 AATACAGAATTGGCTGTATTTGG + Intronic
1063719159 10:8561223-8561245 GAGACAGAATTGCCTGTGATTGG - Intergenic
1063775528 10:9259440-9259462 GAGACAGAATTGAGGGTTATTGG - Intergenic
1064452257 10:15453139-15453161 GATGCAAATTTGCCTGTAATGGG + Intergenic
1065449314 10:25839696-25839718 AAGACAGAATTTCCAGTAATTGG - Intergenic
1065587760 10:27236789-27236811 GAGACAGAATTGCTTGAACCTGG + Intronic
1067106485 10:43370462-43370484 GAGACAGAATTGCTTGAACCTGG + Intergenic
1070253817 10:74796948-74796970 GAGACAGAATTGCTTGAACCCGG - Intergenic
1071826926 10:89334587-89334609 GAGGCAGAATTGCTTGAAACCGG - Intronic
1072061058 10:91811019-91811041 GAGACAGAATTGCTTGAACCCGG - Intronic
1072271184 10:93778821-93778843 GAGACAAAAATGCCTGTCCTTGG + Intronic
1072320169 10:94241691-94241713 GAGGCAGAATTGCCTGAACCTGG + Intronic
1073781403 10:106842708-106842730 GAGGCAGAATTGCTTGAAACTGG - Intronic
1073898142 10:108186672-108186694 GACAAAGAATTGCCTGAAATGGG - Intergenic
1074762955 10:116681093-116681115 AAAACAGAACTGCCTGGAATTGG + Intronic
1075199053 10:120387014-120387036 GAGACAGAGATGCCTGTAGAAGG - Intergenic
1075523147 10:123156838-123156860 GAGGCAGAATTGCCTGAATGCGG - Intronic
1077664914 11:4099234-4099256 GAGGCAGAATTGCCTGAACCTGG - Intronic
1078225706 11:9389851-9389873 GAGGCAGAATTGCCTGAACCCGG - Intronic
1078234068 11:9467748-9467770 GAGACAGAACTGCTTGAACTTGG + Intronic
1081194284 11:40142183-40142205 GAGGCAGAATTGCTTGGACTTGG + Intronic
1082048382 11:47749460-47749482 GAGGCAGAATTGCTTGAAACTGG + Intronic
1083770092 11:64862264-64862286 GCGACAGAATTCACTTTAATTGG - Intronic
1085916277 11:80891894-80891916 CAGACAGAATTCCCTTTAATAGG - Intergenic
1086091492 11:83009160-83009182 GAGACAGAATTGCTTGAACCTGG - Intronic
1086455769 11:86956955-86956977 GCCACAGAATTGGCTGAAATGGG - Intergenic
1088225025 11:107610567-107610589 GACACAGAATTGCTTGAAACCGG + Intronic
1089451250 11:118598888-118598910 GAGACAGAATTGCTTGAACCCGG - Intronic
1089687330 11:120163336-120163358 GAGACAGAATTTCAAGGAATTGG + Intronic
1091479311 12:810151-810173 GAGGCAGAATTGCCTGAACCCGG + Intronic
1091560309 12:1607218-1607240 GAGGCAGAATTGCTTGAACTGGG + Intronic
1091898592 12:4124373-4124395 GAGGCAGAATTGCCTGAACCCGG - Intergenic
1092249956 12:6888878-6888900 GAGACAGAATTGCTTGAACCTGG - Intronic
1095428263 12:42103052-42103074 GAGACAGAATTGCTTGAACCAGG - Intronic
1096991559 12:55808410-55808432 GAGGCAGAATTGCTTGAACTCGG - Intronic
1097004941 12:55909654-55909676 GGGACAGAATTGGCTGAAACAGG + Intronic
1100441606 12:94622299-94622321 GAGATATAATTGCCTCTAATTGG + Intronic
1100853821 12:98740549-98740571 GAGAAAGCAGTGCCTGTAAGAGG - Intronic
1101898651 12:108774704-108774726 GAGACAGAATTGCTTGAACCCGG - Intergenic
1101920705 12:108930529-108930551 GAGGCAGAATTGCTTGAACTGGG - Intronic
1102047150 12:109836412-109836434 GAGACAGAATTGCTTGAACCTGG + Intergenic
1102103096 12:110296273-110296295 GAGACAGAATTGATTTTAAATGG + Intronic
1102134628 12:110563023-110563045 GAGACAGAATTGCCTGAACCTGG + Intronic
1103391252 12:120575140-120575162 GAGACAGAATTGCTTGAACCTGG + Intronic
1104617115 12:130279910-130279932 GAGACAGAATTGCTTGAACCTGG + Intergenic
1105378792 13:19867254-19867276 GAGGCAGAATTGCTTGAACTTGG + Intergenic
1105709165 13:22989722-22989744 GTGACAGAATGGTCTGTCATCGG - Intergenic
1105716892 13:23075534-23075556 GAGACAGAATTGTTTGAACTCGG - Intergenic
1105864429 13:24446749-24446771 CACACAGAGTTGCCTGAAATGGG + Exonic
1106147132 13:27059662-27059684 GAGACAGAATTGCTTGAATCCGG + Intergenic
1106902551 13:34369127-34369149 GAAAAAAAATTGCTTGTAATTGG - Intergenic
1107408783 13:40139409-40139431 GAGACAGAATTACATTAAATTGG + Intergenic
1108132546 13:47318406-47318428 GATACAGTATTGTCTATAATAGG + Intergenic
1108669794 13:52674146-52674168 GAGACAGAATTGCTTGAATCTGG - Intronic
1109402650 13:61855744-61855766 GAGACAGAATTGCTTGAACCCGG - Intergenic
1109597459 13:64575207-64575229 GAGACAGAATTGACAATGATTGG - Intergenic
1111190977 13:84806022-84806044 GAGACAGAATTGCTTGAACCTGG - Intergenic
1111351175 13:87033600-87033622 CAGACAGAATAGCATGAAATGGG - Intergenic
1111930541 13:94508789-94508811 GAGGCAGCATCTCCTGTAATTGG - Intergenic
1111991902 13:95124782-95124804 GAGGCAGAATTGCCTGAACCTGG + Intronic
1112427626 13:99318084-99318106 GAGAGAGAATTGGGTGTAAAAGG - Intronic
1112532952 13:100222666-100222688 AAGACAGAATTACCTGTAATTGG - Intronic
1114496151 14:23133728-23133750 GAGGCAGAATTGCCTGAACCCGG + Intronic
1114646980 14:24261306-24261328 GAGACAGAATTGGCAGAGATGGG + Intronic
1115547094 14:34473913-34473935 GAGGCAGAATCGCCTGAAACTGG - Intergenic
1115554943 14:34537974-34537996 CAGACAGTATTGCCTGTTGTAGG - Intronic
1117275177 14:54186818-54186840 GAAAAAGATTTGCCTGTCATGGG + Intergenic
1117389722 14:55251165-55251187 GAGACAGAATTGCTTGAACCCGG + Intergenic
1117686849 14:58262299-58262321 GAGGCAGAATTGCTTGAACTGGG - Intronic
1118195012 14:63617172-63617194 GAGACAGAATCGCTTGTACCTGG - Intronic
1118625247 14:67652885-67652907 GAGACAGAATTGCTTGAACCTGG - Intronic
1118929922 14:70232046-70232068 GGGACAGACTTGCCAGAAATGGG + Intergenic
1118954663 14:70469371-70469393 GGGACAGACTTGCCAGAAATGGG - Intergenic
1120076401 14:80163677-80163699 AAGACAGAATTGCATGTCAGTGG - Intergenic
1122479565 14:102038072-102038094 GAGACAGAATTGCTTGAACCTGG - Intronic
1124822071 15:33056171-33056193 GAAATAGAATTGCTGGTAATAGG - Intronic
1124872289 15:33555060-33555082 GAGAAAAAATTTCCTCTAATTGG - Intronic
1125013424 15:34905938-34905960 GAGGCAGAATTGCTTGAACTTGG + Intronic
1126119948 15:45242556-45242578 GAGACAGAATAGCGTTTAAAAGG + Intergenic
1126676543 15:51163641-51163663 GAGACAGAAACGTCTATAATTGG - Intergenic
1128123599 15:65173271-65173293 GAGACAGAATTGCTTGAATCTGG + Intronic
1128288985 15:66462401-66462423 GAGACAGAATTGCTTGAACCCGG + Intronic
1128547050 15:68575429-68575451 GAGGCAGAATTGCTTGAACTTGG - Intergenic
1129277758 15:74458333-74458355 GAGGCAGAATTGCTTGAACTGGG + Intronic
1129567378 15:76637149-76637171 GAGTCAGGATTGACTGTAAATGG - Intronic
1130133635 15:81163661-81163683 GAGGCAGAATTGCTTGAACTTGG - Intronic
1130173775 15:81546457-81546479 GAGACTGAAGTGCCTGGAAGAGG - Intergenic
1131328108 15:91468693-91468715 GAGGCAGAATTCCCTGTTTTTGG + Intergenic
1131579127 15:93624267-93624289 GAGACAGAAGTGTATGTATTAGG - Intergenic
1132074042 15:98804789-98804811 GAGGCAGAATTGCTTGAACTGGG - Intronic
1132258035 15:100395184-100395206 GAGACAGTGTTGCCTGTTACTGG + Intergenic
1132502127 16:289180-289202 GAGGCAGAATTGCTTGAACTCGG - Intronic
1134166335 16:11932862-11932884 GAGGCAGAATTGCTTCAAATTGG + Intronic
1134762680 16:16728051-16728073 GAGACAGCAGTGCCCGTGATAGG - Intergenic
1134783065 16:16916420-16916442 GAGGCAGAATTGCTTGAACTCGG - Intergenic
1134983372 16:18631097-18631119 GAGACAGCAGTGCCCGTGATAGG + Intergenic
1135132687 16:19866021-19866043 GAGGCAGAATTGCCTGAACCCGG - Intronic
1135425180 16:22328990-22329012 GAGACAGAATTGCTTGAACCTGG + Intronic
1136516703 16:30772913-30772935 GAGGCAGAATTGCTTGGACTCGG + Intronic
1136846208 16:33578066-33578088 GAGACAGAATTGCTTGAACCCGG + Intergenic
1138411812 16:56846312-56846334 GAGACAGAATTGCTTGAACCCGG + Intronic
1139348585 16:66321099-66321121 GAGACAGAAGTCCCTGTAAAGGG - Intergenic
1139615978 16:68092357-68092379 GAGGCAGAATTGCTTGAACTTGG + Intronic
1140093844 16:71858648-71858670 GAGGCAGAATTGCTTGAACTCGG + Intronic
1140272464 16:73479324-73479346 GAGGCAGAAGAGCCTGGAATGGG - Intergenic
1140505936 16:75472814-75472836 GAAACAGTGTTGCCTGGAATAGG - Exonic
1140822139 16:78672577-78672599 GTGCCTAAATTGCCTGTAATGGG + Intronic
1141605033 16:85147942-85147964 GAGACAGAATTGCTTGAACCCGG - Intergenic
1203107916 16_KI270728v1_random:1426720-1426742 GAGACAGAATTGCTTGAACCCGG + Intergenic
1143459640 17:7093908-7093930 GAGGCAGAATTGCCTGAACCTGG - Intergenic
1143524688 17:7465362-7465384 GAGGCAGAATTGCTTGAACTGGG + Intronic
1144414693 17:15034939-15034961 GAGGCAGAATTGCTTGAACTTGG + Intergenic
1144787264 17:17838881-17838903 GAGACAGAATTGCTTGAACCTGG - Intergenic
1145945787 17:28773383-28773405 GAGACAGAATTGCTTGAACCTGG + Intronic
1146188117 17:30739472-30739494 GAGGCAGAATTGCTTGAACTTGG - Intergenic
1146200863 17:30857310-30857332 GAGGCAGAATTGCTTGAACTCGG - Intronic
1146332982 17:31943792-31943814 GAGGCAGAATTGCTTGAACTTGG - Intronic
1147398879 17:40167056-40167078 GAGGCAGAATTGCTTGAACTGGG - Intronic
1148063837 17:44854421-44854443 AAGACAGATGTGCCTGTAAGGGG + Intronic
1149354892 17:55829402-55829424 GAGACAGAATTGCTTGAACTGGG - Intronic
1149542368 17:57477302-57477324 GTGACACAATTGCCTGTTAATGG + Intronic
1149854106 17:60064210-60064232 GAGACAGAATTGCTTGAACCCGG + Intronic
1149911643 17:60572271-60572293 GAGCCAGAATTGCTTGAACTTGG + Intronic
1150117758 17:62569206-62569228 GAGACAGAATTGCTTGAACCTGG + Intronic
1151024387 17:70660142-70660164 GAGAAAAAATGGCCTGTAAGTGG + Intergenic
1151871169 17:76837913-76837935 GAGACAGAATTGCTTGAACCTGG + Intergenic
1152444928 17:80336805-80336827 GAGACAGAATTGCTTGAACCCGG + Intronic
1152940789 17:83172153-83172175 GAGACAGACTAGCCTGGAGTTGG + Intergenic
1154022323 18:10675441-10675463 GAGAGAGTTTTGACTGTAATAGG - Intronic
1154027432 18:10722055-10722077 GAGGCAGAATTGCTTGAACTCGG + Intronic
1154238064 18:12624736-12624758 GAGACAGAATTGCTTGAACCTGG + Intronic
1157252898 18:46111416-46111438 GAGACAGAATTGCTTGAGCTGGG - Intronic
1157928440 18:51791745-51791767 GAGAAAGAATAGCCTGTGTTGGG + Intergenic
1159920170 18:74220692-74220714 GAGGCAGAATTGCTTGAACTTGG + Intergenic
1160931672 19:1573409-1573431 GAGACAGAATTGCCTGAACTGGG + Intergenic
1161205508 19:3039118-3039140 GAGACAGAATTGCTTGAACCCGG + Intronic
1161721922 19:5907690-5907712 GAGGCAGAATTGCTTGAACTCGG + Intronic
1161853630 19:6751812-6751834 GAGGCAGAATTGCTTGAACTCGG - Intergenic
1161958127 19:7507484-7507506 GAGACAGAATTGCTTGAACCAGG + Intronic
1161962604 19:7530835-7530857 GAGACAGAATTGCTTGAACCCGG - Intronic
1162763517 19:12903481-12903503 GAGACAGAATTGCTTGAACCTGG - Intronic
1162807843 19:13147798-13147820 GAGACAGAATTGCTTGAACCCGG + Intronic
1163733575 19:18964688-18964710 GAGACAGAATTGCTTGAACCAGG - Intergenic
1163756599 19:19110247-19110269 GAGACAGAATTGCTTGAACCCGG + Intronic
1163771444 19:19193510-19193532 GAGGCAGAATTGCTTGAACTCGG - Intronic
1165762572 19:38330232-38330254 GAGACAGAATTGCTTGAACCTGG + Intergenic
1165974192 19:39660099-39660121 GAGACACAGTTGCTGGTAATGGG + Intronic
1166019927 19:40018065-40018087 GAGGCAGAATTGCCTGAACCCGG - Intergenic
1167615283 19:50529706-50529728 GAGGCAGAATTGCATGAACTTGG + Intronic
1167641286 19:50683310-50683332 TAGCCACAATTGCCTGTATTTGG - Intronic
1167667209 19:50829721-50829743 GAGACAGAATTGCTTGAACCTGG + Intronic
1167855352 19:52233690-52233712 GAGGCAGAATTGCTTGAACTGGG - Intergenic
1167871408 19:52373765-52373787 GAGGCAGAATTGCTTGAAAACGG - Intronic
1167990322 19:53355339-53355361 GAGACAGAATTGCTTGGACGTGG - Intergenic
1168227103 19:55003570-55003592 GAGGCAGAATTGCTTGAACTTGG - Intergenic
1168547384 19:57264661-57264683 GAGACAGAATTGCTTGAACCTGG - Intergenic
1168614290 19:57825383-57825405 GAGGCAGAATTGCTTGAACTGGG - Intronic
1168695785 19:58403870-58403892 GAGACAGAATTGCTTGAACCCGG + Intronic
927742113 2:25580425-25580447 GTGACAGAATTGCTTGAACTCGG + Intronic
927792689 2:26022868-26022890 GAGACAGAATTGCTTGCACCTGG - Intergenic
927829209 2:26333915-26333937 GAGACAGAATTGCTTGAACCTGG - Intronic
928985397 2:37176354-37176376 GAGACAGAATTGCTTGAAACCGG - Intronic
929181721 2:39047762-39047784 GAGGCAGAATTGCTTGAACTTGG - Intronic
929199569 2:39220679-39220701 GAGACAGAATTGCTTGAACCTGG - Intronic
929253728 2:39786611-39786633 GAGACAGAATTGCTTGAACCCGG + Intergenic
930012675 2:46949327-46949349 GAGGCAGAACTGCCTGAATTCGG - Intronic
930789762 2:55313163-55313185 GAGACAGAATAGCTTGAAACTGG - Intronic
931342273 2:61413295-61413317 GAGGCAGAATTGCCTGAACCTGG + Intronic
931391862 2:61851428-61851450 GAGGCAGAATTGCCTGAACCCGG - Intronic
931394130 2:61870823-61870845 GAGGCAGAATTGCTTGAACTTGG + Intronic
931603744 2:64030843-64030865 GAGACAGAATTGACAGTACTGGG + Intergenic
932033372 2:68213639-68213661 GAGACAGACTTGCTTGGCATAGG + Intronic
933069612 2:77840715-77840737 GAGGCAGAATTGCTTGTACCCGG - Intergenic
933496119 2:83052704-83052726 GAGGCAGAATTGCTTGAACTCGG - Intergenic
933656761 2:84894961-84894983 GAGACTGAGTTTCCTTTAATCGG - Intronic
933994015 2:87654691-87654713 TAGTCAGAATGGCCTTTAATAGG - Intergenic
935053176 2:99541589-99541611 GAGACAGAATTGCTTGAACCCGG - Intergenic
936100168 2:109570616-109570638 GAGGCAGAATTGCTTGAACTTGG - Intronic
936299849 2:111296223-111296245 TAGTCAGAATGGCCTTTAATAGG + Intergenic
937032230 2:118750309-118750331 GAGCCAGAATTGGCAGTAATCGG + Intergenic
937032825 2:118754629-118754651 GACACTGATTTGCGTGTAATAGG - Intergenic
938130854 2:128714828-128714850 GAGACAGCATTGCCGGCACTCGG - Intergenic
939771098 2:146320249-146320271 GAGGCAGAATTGCTTGAACTGGG - Intergenic
939854484 2:147341759-147341781 GAGGCAGAATTGCTTGAACTCGG - Intergenic
940390712 2:153129674-153129696 GAGGCAGAATTGCTTGAACTAGG + Intergenic
941179130 2:162236702-162236724 GAGGCAGAATTGCCTGAATCTGG - Intronic
941378839 2:164765979-164766001 GAGACAGAAAACACTGTAATGGG - Intronic
942370960 2:175284099-175284121 GAGACAGAATAGCATCTACTGGG - Intergenic
942662462 2:178281106-178281128 GAGACAGAATTGCTTGAACCTGG - Intronic
942802325 2:179890017-179890039 GAGAGAGATTTGCCTGTGAGCGG + Intergenic
942872930 2:180757543-180757565 GAGACATTATGGCCTGTACTAGG + Intergenic
943050190 2:182904320-182904342 GAGACAGAATTGCCTGAACCTGG + Intergenic
943799916 2:192045037-192045059 GAGAGAGAAGGTCCTGTAATAGG - Intronic
944616164 2:201463238-201463260 GAGGCAGAATTGCTTGAACTTGG + Intronic
945113969 2:206392759-206392781 GAGACAGAACTGATTGTAGTAGG + Intergenic
945219022 2:207465309-207465331 GAGGCAGAATTGCTTGAACTTGG + Intergenic
945949863 2:216028794-216028816 ATTACAGAATTGTCTGTAATTGG - Intronic
947767062 2:232644604-232644626 GAGACAGAATTGCTTGAACCCGG - Intronic
947847598 2:233257906-233257928 GAGACAGAATTGCTTGAACCTGG + Intronic
948244031 2:236462892-236462914 GAGACAGAGTCACCTATAATTGG + Intronic
1169949586 20:11028822-11028844 GAGACAGAATTGCTTGAACCTGG - Intronic
1170268277 20:14494056-14494078 GAGACAGAGATTCCTGTACTGGG + Intronic
1171816660 20:29791998-29792020 GAGACACAGTTGCTTCTAATCGG - Intergenic
1172877472 20:38174410-38174432 GGGAGAGAATTGCCTGCAAAAGG - Intergenic
1175505361 20:59480315-59480337 GAGACAGAATTGCTTGAACTGGG - Intergenic
1176003931 20:62849069-62849091 GAGGCAGAATTGCCTGAACCTGG + Intronic
1177543268 21:22522887-22522909 GAGGCAGAATTGCTTGAAACTGG + Intergenic
1179777082 21:43671780-43671802 GAGACAGAATTGCTTGAACTCGG - Intronic
1180619952 22:17154383-17154405 GAGGCAGAATTGCTTGAACTCGG + Intronic
1181065151 22:20302239-20302261 GAGACAGAATTGCTTGAACCCGG + Intergenic
1181295870 22:21838261-21838283 GAGACAGAATTGCTTGAACCCGG + Intronic
1181556086 22:23672401-23672423 GAGACAGAGCTGCCTTTGATGGG + Intergenic
1181698261 22:24604887-24604909 GAGACAGAGCTGCCTTCAATGGG - Intronic
1181748648 22:24973580-24973602 GAGACAGGATTGTCTCTACTAGG + Intronic
1181763424 22:25073788-25073810 GAGACAGAATTGCTTGAACCTGG - Intronic
1182337662 22:29595390-29595412 GAGACAGAATTGCTTGAACCTGG + Intergenic
1182508449 22:30802382-30802404 GAGATAGACTCGCCTGTAACTGG + Intronic
1182649900 22:31843028-31843050 GAGAAACAATTGTCTGTTATAGG + Intronic
1183925953 22:41206077-41206099 GAGACAGAATTGCTTGAACCCGG - Intronic
1184484487 22:44768091-44768113 GAGGCAGAATTGCTTGAACTCGG - Intronic
1184791377 22:46702386-46702408 GAGGCAGAATTGCCTGAACCTGG - Intronic
1184847395 22:47097515-47097537 GAGACAGAATTGCTTGAACTTGG + Intronic
949876963 3:8632754-8632776 GAGACAGAAGTGCCTGTCAGAGG + Intronic
950846264 3:16018844-16018866 TACACAGAAATGCCTCTAATAGG - Intergenic
950969381 3:17170886-17170908 GAGACTGAATTGCCTTTAACTGG + Intronic
951148963 3:19264885-19264907 GAGTCAGAATTGCCAGGACTTGG - Intronic
952023026 3:29045660-29045682 GAATCAGAACTGCGTGTAATTGG + Intergenic
953366358 3:42348702-42348724 GAGGCAGAATTACCTTTAATTGG + Intergenic
954203224 3:49037880-49037902 GAGGCAGAATTGCTTGAACTTGG + Intronic
955051376 3:55414365-55414387 GAGAGAGAACTGCATGTAAAAGG + Intergenic
955090201 3:55743103-55743125 AAGACAGAATTCTCCGTAATTGG - Intronic
955501769 3:59592275-59592297 GAGGCAGAATTGCTTGAAACTGG - Intergenic
955810092 3:62778982-62779004 GAGACAGAATTGCTTGAACCCGG - Intronic
957025110 3:75172932-75172954 TAGACAAAACTGCCTGAAATGGG - Intergenic
957611689 3:82474751-82474773 AAGACAGGATTGCCTGAATTTGG - Intergenic
958911566 3:100000024-100000046 GAGTCTTATTTGCCTGTAATGGG + Intronic
961103532 3:124221896-124221918 GGGAGAGAATTGCCTGAGATGGG + Intronic
962794359 3:138837591-138837613 GAGACAGAATTGCTTGAACCTGG + Intergenic
963773399 3:149413662-149413684 GAGGCAGAATTGCTTGAACTTGG - Intergenic
964556334 3:157943867-157943889 GAGGAAGAATTGCCTGTGAATGG + Intergenic
965301385 3:167009920-167009942 GTGACAGAAATGACTGGAATGGG + Intergenic
965376095 3:167926230-167926252 TAGACAAAAATGCCTGTAACTGG + Intergenic
965869033 3:173244313-173244335 GAGACAGAATTGACTCTGACAGG + Intergenic
966811907 3:183854146-183854168 GAGACAGAATTGCCTGAACCTGG + Intronic
966819907 3:183916096-183916118 GAGGCAGAATTGCTTGAACTCGG + Intergenic
967056816 3:185836475-185836497 GAGACAGAATTGCTTGAACCTGG - Intergenic
967638327 3:191831418-191831440 GAGGCAGAATTGCTTGAACTTGG + Intergenic
968040560 3:195585588-195585610 GAGAGAGAATTTTTTGTAATAGG - Intergenic
970541038 4:17079640-17079662 GAGGCAGAATTGCTTGAACTTGG + Intergenic
971173743 4:24261232-24261254 GAGATAGATTTGCCTGGCATTGG - Intergenic
971397697 4:26244719-26244741 GAGGCAGAATTGCCTGAACCTGG - Intronic
972487594 4:39557106-39557128 GAGGCAGAATTGCTTGAACTTGG - Intronic
972589574 4:40471598-40471620 GAGACAGAATTGCTTGAATCCGG + Intronic
972679835 4:41294751-41294773 GAGTCACTATTGCCTGTAAAAGG + Intergenic
973537549 4:51898547-51898569 GAGGAAGAATTGCCTTTAAATGG + Intronic
973559080 4:52116173-52116195 GAGTCAGAACTGTCTGTCATTGG + Intergenic
974220508 4:58963520-58963542 GGGAGAGAATTGACTGTAAGTGG - Intergenic
975822727 4:78288315-78288337 GTGACAGATTTGCCTTTAAAAGG + Intronic
976625538 4:87177408-87177430 GAGGCAGAATTGCCTGAACCTGG + Intronic
976867768 4:89751435-89751457 GGGAAAAAAATGCCTGTAATAGG - Intronic
978389758 4:108213221-108213243 GAGACAGAATTACCACTAACGGG - Intergenic
982543953 4:156709866-156709888 GAGAAAGCATAGCCTGTACTTGG - Intergenic
983054539 4:163085956-163085978 GAGGCAGAATTGCTTGAACTTGG + Intergenic
983152045 4:164296464-164296486 GAGGCAGAATTGCTTGAAACTGG - Intronic
986757622 5:10853113-10853135 CTGACAGAATTGCCTGGAATTGG - Intergenic
986825362 5:11514894-11514916 GAGACAGAATTGCTTGAACCTGG - Intronic
988312756 5:29582396-29582418 GAGACAGAATTGCTTGAACCTGG + Intergenic
989277401 5:39605433-39605455 GAGTCATAATTGCCTCTTATTGG + Intergenic
990141620 5:52711125-52711147 GAGACAGACTTCCTTGTAAAGGG - Intergenic
990762433 5:59144861-59144883 GAGACCGTATTCCCTTTAATAGG + Intronic
992612047 5:78516367-78516389 GGGACAGAATTGCCCCTAATTGG - Intronic
992741167 5:79774763-79774785 GGAACAGAATTGCCTGTCATAGG + Intronic
993070967 5:83163041-83163063 GAGGCAGAATTGCTTGAACTTGG - Intronic
993453808 5:88104425-88104447 GAGATGGAATTGACTGGAATTGG + Intergenic
995431573 5:112085153-112085175 GAGACAGAATTGCTTGAACCCGG - Intergenic
996743091 5:126820046-126820068 GAGACAGAATTGCTTGAACCTGG + Intronic
997857926 5:137390090-137390112 GAGACAGGATTTCCTTTAGTAGG - Intronic
998141662 5:139703178-139703200 GAGGCAGAATTGCTTGAAACTGG + Intergenic
999162589 5:149516221-149516243 GAGACAGAATTGCTTGAACCTGG + Intronic
999888926 5:155955991-155956013 GAGTCAGTATTACTTGTAATAGG + Intronic
999928154 5:156402477-156402499 GAGACAGCGTTGCCTGTTACTGG + Intronic
1000585985 5:163099535-163099557 GAGCCAGAATTTCCTTCAATAGG + Intergenic
1001269614 5:170301545-170301567 GAGACAGAATTGCTTGAACCTGG + Intergenic
1001351866 5:170975430-170975452 GAGACAGAATTGCATGAACCTGG + Intronic
1001929205 5:175660757-175660779 TAGACTGAATTGCCTCTAAAAGG + Intronic
1003238278 6:4318105-4318127 GAGACAGAAGTGCCTGTGCTTGG + Intergenic
1003464619 6:6366842-6366864 AAGACAGCAGTGGCTGTAATCGG + Intergenic
1003707271 6:8546807-8546829 GAGACAGAACTGACTGGGATGGG + Intergenic
1003900878 6:10654329-10654351 GAGACAGAATTGCTTGAACCTGG + Intergenic
1004694899 6:18024584-18024606 GAGACAGAATTGCTTGAACCCGG - Intergenic
1006397653 6:33797503-33797525 GAGACAGAGTAGCCTGTGGTTGG - Intronic
1006637519 6:35471212-35471234 GAGGCAGAATTGCTTGAACTGGG - Intergenic
1006769682 6:36542549-36542571 GAGGCAGAATTGCTTGAATTGGG + Intronic
1007489710 6:42209649-42209671 GAGACAGAATTGCTTGAACCCGG + Intronic
1007999499 6:46344057-46344079 GAGAAAGAACTGCCTGCAAAAGG + Intronic
1008537144 6:52515076-52515098 GAGACAGAGTTCCTTGTGATGGG + Intronic
1008946768 6:57106401-57106423 GAGACAGAATTGCTTGAACCCGG - Intronic
1009318743 6:62257869-62257891 GAGAAAAAATTTTCTGTAATTGG - Intronic
1010381698 6:75232712-75232734 GAGACAGAATTGCTTGAACTTGG + Intergenic
1011144670 6:84200154-84200176 GAGACAGAATTGCATGAACCTGG + Intronic
1012423142 6:99086254-99086276 GAGAAAGAGTTGACTGTACTTGG - Intergenic
1012468729 6:99546060-99546082 GAGACAGAATTGCTTGAACCTGG - Intronic
1013454583 6:110318555-110318577 GAGGCAGAATTGCTTGAAACCGG + Intronic
1014351325 6:120349838-120349860 TATAAAGAAATGCCTGTAATTGG + Intergenic
1016952384 6:149592829-149592851 GAGGCAGAATTGCTTGAACTTGG - Intergenic
1018216874 6:161536940-161536962 GACCCAGAACTTCCTGTAATGGG - Intronic
1018279640 6:162171849-162171871 GATACGGACTTGCCTGTATTTGG + Intronic
1019374907 7:684213-684235 GAGACAGAATTGGCTGGCACAGG - Intronic
1019802767 7:3100397-3100419 GAGATAGAATTGCTTGAACTTGG + Intergenic
1021948370 7:25750825-25750847 GCCACAGAATTGACTGTATTTGG + Intergenic
1023872431 7:44270082-44270104 GAGGCAGAGCTGCCTGGAATGGG - Intronic
1024036656 7:45512545-45512567 GAGACAGAAGTTCCTGTGCTTGG - Intergenic
1024359880 7:48456819-48456841 TATACAGCATTGCCTATAATAGG - Intronic
1024826276 7:53394230-53394252 GAGACAGAATTGCTTGAACCTGG + Intergenic
1024863614 7:53876654-53876676 GAGACAGAATTGCTTGAACCTGG + Intergenic
1025795253 7:64733637-64733659 GAGACAGAATTGCTTGAACCCGG + Intergenic
1025807881 7:64852878-64852900 GAGGCAGAAACGTCTGTAATGGG - Intergenic
1026270870 7:68835622-68835644 GAGACAGAATTGCTTGAACCTGG + Intergenic
1026684877 7:72501051-72501073 GAGACAGAATTGTCTTTAGGAGG - Intergenic
1028129622 7:87154079-87154101 GAGACAGGATTTCATGTATTTGG + Intronic
1029282637 7:99446254-99446276 GAGACAGAATGCCCTGTGTTAGG - Intronic
1029406513 7:100377647-100377669 GAGACAGAATTGCTTGAACCCGG + Intronic
1029415430 7:100440178-100440200 GAGGCAGAATTGCCTGAAGCTGG + Intergenic
1032435101 7:131894340-131894362 GATAGAGTTTTGCCTGTAATAGG - Intergenic
1034157458 7:148967304-148967326 GAGGCAGAATTGCTTGAACTTGG - Intergenic
1034503214 7:151465155-151465177 GAGACAGAATTGCTTGAACCTGG + Intergenic
1036803843 8:11813784-11813806 GAAACAGAATTACCTGGAAGCGG + Intronic
1036811733 8:11871687-11871709 GAGGCAGAATTGCTTGAACTCGG - Intergenic
1038186485 8:25279709-25279731 GAGGCAGAATTGCTTGAACTTGG - Intronic
1039310359 8:36311861-36311883 GAGACAGAATTCTCTGCAAATGG - Intergenic
1039518539 8:38152617-38152639 GAGGCAGAATTGCTTGAACTTGG + Intergenic
1039726551 8:40223686-40223708 GAGACAGAATTGCTTGAACCTGG - Intergenic
1043108284 8:76143942-76143964 GAGATGGAAATGCCTGGAATAGG + Intergenic
1043588608 8:81798607-81798629 GAGACAGAATTGCTTGAACCCGG + Intergenic
1044020520 8:87100570-87100592 GAGACAGAATTGCTTGAACTTGG - Intronic
1045101814 8:98852229-98852251 GAGACAGAATTGCTTGAACCTGG - Intronic
1045285735 8:100789606-100789628 GAGACAGAATTGGGTGGACTTGG + Intergenic
1046117793 8:109804933-109804955 GAGGCAAAATTGCTTGTAAGAGG + Intergenic
1047004380 8:120604545-120604567 GAGGCAGAATTGCCTGAACCCGG - Intronic
1049965246 9:773632-773654 GAGACAGAATTGCTTGAACCTGG - Intergenic
1050970917 9:11872408-11872430 GAGAAATAAATGACTGTAATAGG + Intergenic
1051908930 9:22130300-22130322 GAGACAGAATTCTCTTTAAGTGG - Intergenic
1053702086 9:40705073-40705095 GAAACAGAATTGTTTGTAAAGGG - Intergenic
1054412146 9:64828533-64828555 GAAACAGAATTGTTTGTAAAGGG - Intergenic
1055639779 9:78310702-78310724 GAGACAGAATTGCTTGAACCCGG - Intronic
1055677530 9:78680069-78680091 GAGAGAGAATTTCCTGGAAGTGG + Intergenic
1057148443 9:92774989-92775011 GAGACAGAATTGCTTGAACCTGG + Intergenic
1057406412 9:94775461-94775483 GAGACAGAATCGCCTGAACCCGG - Intronic
1057722314 9:97542754-97542776 GAGACAGAATTGCTTGAACCCGG + Intronic
1057734585 9:97643746-97643768 GAGACAGAATTGACAGGGATTGG - Intronic
1057805627 9:98217687-98217709 GAGAAAGAGTTGCATGTAGTTGG - Intronic
1059416000 9:114162856-114162878 GAGACAGCCGTGCCTGTAATTGG + Intronic
1059432175 9:114256972-114256994 GAGTCAGAACTGCCTTTTATGGG + Intronic
1059890268 9:118794452-118794474 GTGTCAGAATTGCCTATGATGGG + Intergenic
1060843675 9:126817023-126817045 CCGTCAGAATTGCCTGGAATAGG + Intronic
1061424095 9:130488531-130488553 GAGACAGAAATGCCTGGTCTTGG - Intronic
1185966422 X:4609952-4609974 GAGGCAGAATTCCCTGTTCTTGG - Intergenic
1186327642 X:8497476-8497498 GAGACAGAATTGCTTGAACCTGG - Intergenic
1187656908 X:21486036-21486058 GAGACAGAATTGCTTGAACCCGG + Intronic
1187904349 X:24052317-24052339 GAGGCAGAATTGCTTGAAACTGG - Intergenic
1189479426 X:41381425-41381447 GAGGCAGAATTGCTTGAACTTGG - Intergenic
1190767894 X:53490760-53490782 GAGGCAGAATTGCTTGAATTCGG - Intergenic
1193449923 X:81653126-81653148 GGGACAGAAATTCCAGTAATAGG - Intergenic
1196738116 X:118998792-118998814 GAGGCTGAATTGCCTGAACTGGG - Intronic
1197143931 X:123149598-123149620 GAGACAGAAGTTCCTGTGCTTGG - Intergenic
1197154612 X:123256903-123256925 GAGACAGAATTGACAGAACTTGG + Intronic
1199006732 X:142708385-142708407 GAAACAGAATGTCCTTTAATAGG + Intergenic
1199013331 X:142782238-142782260 GAGGGAGAATTGCCTCTATTAGG + Intergenic
1200442854 Y:3231956-3231978 GAGAGAGTATTACCTGTTATAGG - Intergenic
1202604597 Y:26628010-26628032 CACACAGAGTTGCCTGAAATGGG + Intergenic