ID: 919350907

View in Genome Browser
Species Human (GRCh38)
Location 1:196452800-196452822
Sequence GTCTGAAGTCAGTTAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919350902_919350907 -1 Left 919350902 1:196452778-196452800 CCCAGGGAAAGCCAGTGTTGAAG 0: 1
1: 0
2: 4
3: 22
4: 218
Right 919350907 1:196452800-196452822 GTCTGAAGTCAGTTAGTGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 162
919350903_919350907 -2 Left 919350903 1:196452779-196452801 CCAGGGAAAGCCAGTGTTGAAGT 0: 1
1: 0
2: 4
3: 64
4: 316
Right 919350907 1:196452800-196452822 GTCTGAAGTCAGTTAGTGGAGGG 0: 1
1: 0
2: 0
3: 20
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919350907 Original CRISPR GTCTGAAGTCAGTTAGTGGA GGG Intronic
901097577 1:6694506-6694528 CTCTGAAGTCAGCTTGGGGAAGG - Intronic
901111744 1:6802674-6802696 GTGTGGAGTAAGTTAGTGGTAGG + Intronic
904829545 1:33298040-33298062 GTCTGAAGTCAAGGAGTGGCAGG + Intronic
908008973 1:59756138-59756160 GTCTGGAGTCATTTTGTGGAGGG - Intronic
908037891 1:60075232-60075254 GCTTGAAGTCAGATAGTGGAAGG - Intergenic
908161683 1:61414972-61414994 GTCTGATGTCACTTAGTGCCAGG + Intronic
908395875 1:63725281-63725303 GTCTGAAGTCACCTGGGGGATGG - Intergenic
911133432 1:94414639-94414661 AACTGAAGTCAATTTGTGGAGGG - Intergenic
911769556 1:101723082-101723104 ATCTGTATTAAGTTAGTGGACGG - Intergenic
916806230 1:168264265-168264287 GTCTGAAGGGAGTTCGTGGATGG + Intergenic
917492430 1:175508817-175508839 GTCTTAAGCCAGTTAGTGTGGGG + Intronic
919350907 1:196452800-196452822 GTCTGAAGTCAGTTAGTGGAGGG + Intronic
919450615 1:197768427-197768449 GTCTTAAGTCACTTTGGGGAAGG + Intronic
920695128 1:208175945-208175967 GTCTGAAGTGAATTGATGGATGG + Intronic
922044088 1:221926911-221926933 GCCTGAAGCAAGTAAGTGGAAGG + Intergenic
1064886105 10:20114247-20114269 GGCTGAGGTCAGATGGTGGAAGG - Intronic
1067256157 10:44644351-44644373 GTTTGAAGTCAGGTAGTGTGAGG - Intergenic
1068339574 10:55684490-55684512 GTTTGAAGTCAGGTAGTGTGAGG + Intergenic
1068938974 10:62662407-62662429 GTCTGAAGGCAGGGAATGGAAGG - Intronic
1070469077 10:76760010-76760032 GGTTGAAGGAAGTTAGTGGATGG - Intergenic
1071004471 10:80866608-80866630 GTTTGAAGTCAGGTAGTGTGAGG + Intergenic
1072084858 10:92068730-92068752 GTCAGAAGTCAGGACGTGGAAGG + Intronic
1073933861 10:108606806-108606828 GTTTGAAGTCAGGTAGTGTGAGG + Intergenic
1074280100 10:112043311-112043333 GTCTGAAGTCAGGTAGTGTGAGG - Intergenic
1074945144 10:118274363-118274385 GTCTGGGGTCATTTAGTGGAGGG - Intergenic
1078489268 11:11754292-11754314 GACTGAAGTCACCTCGTGGAGGG - Intergenic
1079809874 11:24983930-24983952 GTCTAAAGTAGGTTGGTGGAGGG - Intronic
1080000904 11:27348027-27348049 ATCTGAAGCCACTTAGTGGCTGG - Intronic
1085465156 11:76718059-76718081 TTCTGAAGAGAGTTAGTGGTGGG - Intergenic
1086398231 11:86439091-86439113 GGATGAAGGCAATTAGTGGAGGG + Intergenic
1087525965 11:99313411-99313433 GTCTAGAATAAGTTAGTGGATGG - Intronic
1088304037 11:108389311-108389333 GTCTGCAGTTAGCTAGGGGAAGG + Intronic
1090407414 11:126485317-126485339 CTCTGAAGTCAGCTAGTTCAGGG - Intronic
1091763164 12:3101063-3101085 GTCTGAAGTCATCTGGAGGAGGG + Intronic
1093058419 12:14578270-14578292 GTATGAAGGCACTTGGTGGAAGG + Intergenic
1097875086 12:64635864-64635886 GTTTGAAGTCAAATAGTAGAAGG + Intronic
1098326405 12:69307859-69307881 GTTTGAAGTCAGGTAGTGTGAGG - Intergenic
1100483934 12:95006476-95006498 GTTTGAAGTCAGGAAGTGGAAGG + Intergenic
1101204255 12:102469448-102469470 GTCTGAATTCAGTCTGTGAAGGG + Intronic
1101876601 12:108600149-108600171 ATCTGAGGTGAGTTAGTGGCAGG + Intergenic
1102194942 12:111018369-111018391 GTCTGAAATCATCTAGTGAATGG - Intergenic
1104163718 12:126205786-126205808 GTTTGAAGTGAGCTTGTGGATGG - Intergenic
1104357644 12:128101759-128101781 TTCTGAAGTGAGTGAGTGAAGGG - Intergenic
1106724699 13:32471845-32471867 GTCTGAAGGGAGTGGGTGGATGG - Intronic
1107883935 13:44858291-44858313 GGGTGCAGTCAGTCAGTGGAAGG - Intergenic
1108590026 13:51905184-51905206 GGCTGAAGGCAGTTCGTGCAGGG + Intergenic
1109617300 13:64852113-64852135 CTTTGAAGACATTTAGTGGAAGG + Intergenic
1109743960 13:66595497-66595519 GTTTGCAGTCTCTTAGTGGATGG + Intronic
1109907300 13:68861372-68861394 ATCTGAAGTCAGTTTGTGTGAGG + Intergenic
1111460503 13:88535558-88535580 GACTCAAGTTAGTTAGTGAAAGG + Intergenic
1113993720 14:16050297-16050319 GTTTGAAGTCAGGTAGTGTGAGG + Intergenic
1115913068 14:38277835-38277857 GTCTGATGTAACTGAGTGGATGG - Intergenic
1118459401 14:65974944-65974966 AGCTGAAGGCAGGTAGTGGAGGG + Intronic
1119571805 14:75681224-75681246 ATCTGATGTCTGTTAGTGGCAGG + Intronic
1119710450 14:76818387-76818409 GTCTGAAAGCAGTTAGGGGTGGG - Intronic
1120491653 14:85185748-85185770 GTATGAAGTCAAGTAGTGGAGGG - Intergenic
1120823362 14:88933224-88933246 GTGTGAAGTCAGTGGGAGGAGGG + Intergenic
1124440025 15:29678865-29678887 GTCTGAGGTCCCTTAGGGGACGG - Intergenic
1125496176 15:40196400-40196422 GTTTGAAGTCAGGTAATGTAAGG + Intronic
1131554395 15:93384309-93384331 GTCTTAACTTAGTTGGTGGAAGG - Intergenic
1131790351 15:95958012-95958034 GTCAGAAGTCAGTGAGGGGGAGG + Intergenic
1135922304 16:26662186-26662208 GTTTGAAGTCAGATAGTGTGAGG + Intergenic
1138424531 16:56921972-56921994 GTCTGAAGTCAGCTTGGGGAAGG + Intergenic
1138730868 16:59193356-59193378 GTCTGAAGCAAGTAAGTGGTAGG + Intergenic
1140807023 16:78541975-78541997 GTTTGAAGTCAGTTACCAGAGGG + Intronic
1140822947 16:78679984-78680006 GCATGGAGTCAGTTAGTGGTAGG - Intronic
1143581794 17:7831928-7831950 GTATGAAGTCAGTCAATGAATGG - Intronic
1143893051 17:10116999-10117021 GTTTGAAGCCCGTTAGTGTATGG - Intronic
1144417986 17:15069820-15069842 ATCTGTAGTCAGTCAGTGAATGG - Intergenic
1149239112 17:54628151-54628173 TTCTGCATTCAGTTAATGGAAGG - Intergenic
1149549225 17:57527618-57527640 TTCTGAAGTCAGTTACTGGGAGG - Intronic
1157036244 18:43978489-43978511 GTCTGGAGTCAGTGTGTGGCGGG + Intergenic
1159692318 18:71504485-71504507 GGCTGGAGTTAGTTAGTGGAAGG + Intergenic
1161059972 19:2209954-2209976 CTCTGATGTGAGTTAGTGGAGGG - Intronic
1162463116 19:10824952-10824974 GCCTGAGGTCAGTTATTGGTGGG + Intronic
1163049345 19:14670164-14670186 GATTATAGTCAGTTAGTGGATGG + Intronic
1163997909 19:21069325-21069347 GTTTAAAGTCAGTTAATGGGAGG - Intergenic
1166972353 19:46577726-46577748 GTTTGCAGTCAGATAGTGGCTGG + Intronic
1167565345 19:50252614-50252636 GAATGAAGTCAGGTAGAGGAGGG - Intronic
924984386 2:255759-255781 GTATTAAGTCAGATAGAGGAAGG + Intronic
925275469 2:2645167-2645189 TTCTGAAGGCAGTGGGTGGAAGG - Intergenic
927301629 2:21522408-21522430 GTTTGAAGTCAGGTAGTGTGAGG + Intergenic
928400203 2:30972278-30972300 GTCTGAAGACAGTTAGAGAATGG + Intronic
928476865 2:31635959-31635981 GTTTGAAGTCAAGTAGTGTAAGG + Intergenic
928674938 2:33641055-33641077 TTCTGAACTCTGTTGGTGGATGG + Intergenic
929944834 2:46362451-46362473 TTCTGAAGGCAGTTAGTGGCTGG + Intronic
933421134 2:82046398-82046420 GTTTGAAGTCAGGTAGTGTGAGG - Intergenic
933805398 2:85995341-85995363 GTCTGAAGTCAGTCATTGATGGG - Intergenic
935335528 2:102012302-102012324 CTCTGAAGCCAGCTGGTGGAAGG - Intronic
935378024 2:102420478-102420500 GTCTGAGGCCAGTTGGTGGGTGG + Intronic
937470084 2:122166966-122166988 AGCTGAAGGCAGTTAGTGCATGG + Intergenic
939666556 2:144959736-144959758 GTCAAAAGTCAGTTATTGCAGGG - Intergenic
940270158 2:151881798-151881820 GTCTGTACTCTGTTGGTGGAAGG - Intronic
1169408833 20:5349574-5349596 ATCTGGAGTCAGGAAGTGGAAGG - Intergenic
1172405461 20:34685444-34685466 GGATGAAGTCAGTTCGAGGAAGG + Intergenic
1177416238 21:20796940-20796962 GTCAGAGGTCAGGGAGTGGAAGG + Intergenic
1177643852 21:23877407-23877429 GTCTGCATTCAGTTCATGGATGG - Intergenic
1179807469 21:43848929-43848951 GTCTGAAGTCAGCTGGAGGCCGG + Intergenic
1182726351 22:32449144-32449166 GTCTGAAGTCAGACTGAGGAGGG - Intronic
1183146083 22:35993640-35993662 GTTTGAAGCCAGTAAGTGTAGGG + Intronic
1183568590 22:38634796-38634818 GCCTGCAGTCAGTCAGTGGAAGG - Intronic
949934737 3:9107962-9107984 GTCAGAAGTCAGAGAGAGGATGG + Intronic
953782341 3:45882323-45882345 GTCTGGAGGCAGTTAGTAGTTGG - Intronic
954108104 3:48419948-48419970 GTCTGAAGTCAGTGGGGGCAGGG + Exonic
954493189 3:50927232-50927254 GTTTTAAGTCAGTGAGGGGAAGG - Intronic
956064355 3:65381251-65381273 ATCTGAAGGCAGTTGGAGGAAGG + Intronic
956411363 3:68983302-68983324 GTCTGAAATGAGATAATGGATGG - Intronic
956894062 3:73641638-73641660 CTGTGAATTCAGCTAGTGGAAGG - Intergenic
961500016 3:127325770-127325792 GTCTGCAGTCAGTGGGTGGGTGG + Intergenic
962735750 3:138323693-138323715 TGCTGAAGTCATTTGGTGGAGGG + Intronic
967993410 3:195148747-195148769 GTCTGAAATCAGTTGGTACAAGG - Intronic
968740500 4:2328072-2328094 ATCTGAAATCAGTTTGTTGAAGG + Intronic
970251508 4:14121071-14121093 GTCCGAGGTCAGCTGGTGGATGG - Intergenic
976812043 4:89108665-89108687 GTCTGAGGGGAGTTGGTGGACGG - Intronic
983345280 4:166520990-166521012 GTCTGAAAAGAGTTAGTGAAGGG - Intergenic
983477159 4:168227975-168227997 GTCTGATGTCACTTAATGGCAGG + Intronic
987014443 5:13803547-13803569 GTCTGAATTCACTTAGTTGGTGG - Intronic
989128410 5:38079332-38079354 GTCTGCAGTCAGTTGGTTGGTGG - Intergenic
989881752 5:46798050-46798072 GTTTGAAGTCTGTGAGTTGAAGG - Intergenic
989882095 5:46804865-46804887 GTTTGAAGTCTGTGAGTTGAAGG - Intergenic
989882933 5:46821396-46821418 GTTTGAAGTCTGTGAGTTGAAGG - Intergenic
989887904 5:46918897-46918919 GTTTGAAGTCTGTGAGTTGAAGG - Intergenic
989888794 5:46936456-46936478 GTTTGAAGTCTGTGAGTTGAAGG - Intergenic
989891365 5:46987248-46987270 GTTTGAAGTCTGTGAGTTGAAGG - Intergenic
989893554 5:47030034-47030056 GTTTGAAGTCTGTGAGTTGAAGG - Intergenic
989894275 5:47043593-47043615 GTTTGAAGTCTGTGAGTTGAAGG - Intergenic
991036711 5:62134748-62134770 GTATGAAGTCAGTCAGTCAAAGG + Intergenic
992516546 5:77499603-77499625 CTCTGGTGCCAGTTAGTGGAAGG - Intronic
992600582 5:78395128-78395150 GTCTGAAGTCAAACCGTGGATGG - Intronic
993546283 5:89217312-89217334 GGCTGAACTAAGTTATTGGAGGG + Intergenic
994362249 5:98865564-98865586 GTCTGAGGTCAGTTAGAGCTGGG - Intronic
997487632 5:134245060-134245082 GTCCGAAGGCAGTGGGTGGATGG + Intergenic
998250786 5:140550825-140550847 GACTGAGGTCAGTCAGTGGATGG - Exonic
1000477159 5:161724986-161725008 GACTGGAGTCAGCTAGTGAAAGG + Intergenic
1001308011 5:170589899-170589921 CTCTGCAGTCAGTCAGTGGAGGG + Intronic
1001882187 5:175254018-175254040 GTGTGGAGTCAGTGAGTGGCAGG + Intergenic
1004091867 6:12511698-12511720 ATTTGAAATCAGTTTGTGGAAGG + Intergenic
1005412292 6:25562775-25562797 GTTTGAAGTCATTTTGTGGAGGG - Intronic
1006014526 6:31069175-31069197 GTCTCATGTCAGTGAGTGCAAGG - Intergenic
1009597311 6:65752312-65752334 GTTTGAAGTCAGGTAGTGTGAGG - Intergenic
1010004295 6:70978871-70978893 GTTTGAAGTCAGGTAGTGTGAGG - Intergenic
1012658876 6:101860739-101860761 GTCTAAAGGCAGTTAGTGAGAGG + Intronic
1014529986 6:122547227-122547249 GTCTGAAGGGAGTGGGTGGATGG + Intronic
1018536642 6:164827435-164827457 GTCTGAAGGGAGTGGGTGGATGG - Intergenic
1019398491 7:836567-836589 GTCTGAAGGCAGTTTGTAGCTGG + Intronic
1021855170 7:24848114-24848136 GGCTGAAGTCAGTCAGTACATGG - Intronic
1022289439 7:28986793-28986815 GGCTGGAGTCAGTTTGTGGCAGG + Intergenic
1025170739 7:56754300-56754322 GGCTAAATTCAGTGAGTGGATGG + Intergenic
1025701145 7:63821399-63821421 GGCTAAATTCAGTGAGTGGATGG - Intergenic
1029655722 7:101923124-101923146 GGCTGTAGGGAGTTAGTGGATGG + Intronic
1030776311 7:113537933-113537955 GTTTGAAGTCAGGTAGTGTGAGG - Intergenic
1033319370 7:140326055-140326077 CTCTGAATTGAGTCAGTGGAGGG - Intronic
1033565488 7:142574696-142574718 GTCAGAAGACCGTTAGTGGGAGG + Intergenic
1038345814 8:26731515-26731537 GACTGAGGTCAGATTGTGGAGGG + Intergenic
1041477049 8:58278331-58278353 GTCTGAGGTCAGTTCTTGCAGGG - Intergenic
1041637970 8:60165079-60165101 GTTTGAAGTCAGGTAGTGTGAGG - Intergenic
1042113069 8:65402256-65402278 GCCTAAAGTCACTCAGTGGAAGG - Intergenic
1043320970 8:78986221-78986243 TTTTGAAGTCAGGTAGTGAAAGG - Intergenic
1044201631 8:89445197-89445219 GTTTGAAGTCAGGTAGTGGGAGG + Intergenic
1047827367 8:128592138-128592160 GTCTGAGGCCAGTTAGTGTAAGG - Intergenic
1051247279 9:15124506-15124528 TCCTGAAGTCAGGTAGTGTAAGG - Intergenic
1051696129 9:19769565-19769587 GTCTGGGGTCAGTAAGTGTAGGG - Intronic
1052589868 9:30477704-30477726 GCCTGAAGTCATTTTTTGGAGGG - Intergenic
1055966150 9:81866945-81866967 TTCAGAAGTCATTTAGTGGTTGG + Intergenic
1057824260 9:98360096-98360118 GTCTGAAGTAGGTAAGTGGGAGG + Intronic
1057889861 9:98861601-98861623 TTATGAAGTCAGTTAGCTGAAGG + Intergenic
1058642677 9:107102576-107102598 GGGTGAAGTCAGCTACTGGAAGG - Intergenic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1059397042 9:114041744-114041766 GTTTGAAGTCAGGTAGTGTGAGG + Intronic
1059492168 9:114677052-114677074 GTTAAAAATCAGTTAGTGGAAGG - Intergenic
1059621707 9:116012984-116013006 GTCTGAAATCAGGTATTGGCAGG + Intergenic
1059968771 9:119642874-119642896 GTTTGAAGTCAGGTAGTGTGTGG + Intergenic
1185974199 X:4701099-4701121 GTGTGAAGTCATTTAGTAGGTGG - Intergenic
1187981602 X:24763204-24763226 GTGTGATGGCAGTCAGTGGAGGG + Intronic
1190018391 X:46849381-46849403 ATTTGAAGTGAGTTGGTGGAAGG - Intronic
1190496268 X:51031134-51031156 GCCTGAAGTCAGCAAGTGGTGGG + Intergenic
1190683666 X:52851587-52851609 GTGTGGAGTCTGTTAGTGAAGGG - Intergenic
1190999568 X:55646056-55646078 GGCTGGAGTCTGTTAGTGAAGGG - Intergenic
1191005514 X:55707155-55707177 GTTTGAAGTCAGGTAGTGTGAGG - Intergenic
1191931569 X:66379349-66379371 GTCAGATGTCATTTAGTGGAGGG - Intergenic
1193465777 X:81845745-81845767 GTTTGAAGTCAGGTAGTGTGAGG - Intergenic
1194814495 X:98425743-98425765 GTTTGAAGTCAGGTAGTGTGAGG + Intergenic
1195877033 X:109552288-109552310 AACTCAAGACAGTTAGTGGAGGG - Intergenic