ID: 919351824

View in Genome Browser
Species Human (GRCh38)
Location 1:196466890-196466912
Sequence TACCCAAGGCTGACCCTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 145}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919351824_919351826 -10 Left 919351824 1:196466890-196466912 CCAAGCAGGGTCAGCCTTGGGTA 0: 1
1: 0
2: 1
3: 18
4: 145
Right 919351826 1:196466903-196466925 GCCTTGGGTATAATGCAACTGGG 0: 1
1: 0
2: 0
3: 5
4: 70
919351824_919351828 -9 Left 919351824 1:196466890-196466912 CCAAGCAGGGTCAGCCTTGGGTA 0: 1
1: 0
2: 1
3: 18
4: 145
Right 919351828 1:196466904-196466926 CCTTGGGTATAATGCAACTGGGG 0: 1
1: 0
2: 0
3: 4
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919351824 Original CRISPR TACCCAAGGCTGACCCTGCT TGG (reversed) Intronic
900313920 1:2047871-2047893 TAACCAAGGACGCCCCTGCTGGG - Intergenic
900922117 1:5679532-5679554 TCCCCCAGGCTGTCCCTGTTGGG + Intergenic
901288836 1:8105697-8105719 TAACCAAGTCAGACCATGCTGGG + Intergenic
901809089 1:11756046-11756068 TGTCCAAGGCTGTCCCTTCTGGG - Intergenic
902196180 1:14800144-14800166 ACCCCAAGGCTGACCCAGCATGG + Intronic
903268364 1:22172389-22172411 AACCCAAGTCTGAACCTGCCAGG - Intergenic
903969704 1:27110754-27110776 TCCTCAAAGCTGAGCCTGCTGGG - Intronic
905311375 1:37051480-37051502 TATCCAAGCCAGACCCTGCGGGG + Intergenic
906078038 1:43066666-43066688 TACCCAAGGCAGTCTCTCCTGGG - Intergenic
907251319 1:53141712-53141734 TCCCCCAGGCTGCCCCTTCTCGG + Intronic
909639931 1:77861635-77861657 TACCCAAAGCTGTCCTTGCATGG - Intronic
916126311 1:161574507-161574529 AACCCAATGTTGACTCTGCTAGG - Intergenic
916136230 1:161656347-161656369 AACCCAATGTTGACTCTGCTAGG - Intronic
917743116 1:177981004-177981026 TACTGAAGACTGTCCCTGCTTGG + Intronic
919351824 1:196466890-196466912 TACCCAAGGCTGACCCTGCTTGG - Intronic
919357209 1:196538319-196538341 GACCAAAGGCTCACCCAGCTGGG + Intronic
921825258 1:219665387-219665409 CACACAATGCTGACCCTGATGGG + Intergenic
923295772 1:232593879-232593901 CATCCAGGGCAGACCCTGCTTGG + Intergenic
924604552 1:245521598-245521620 ACCCCCAGGCTGACCCTGTTGGG + Intronic
924710072 1:246524091-246524113 TGCCCAGGGATGACCCTCCTCGG + Intergenic
1065106677 10:22395260-22395282 TACCCAGGGATGAAACTGCTGGG + Intronic
1067523686 10:47026204-47026226 TACCCTAGGCTCACACAGCTGGG - Intergenic
1069647175 10:70009213-70009235 TACCAAAGCCTAACCCTACTAGG + Intergenic
1071129610 10:82375701-82375723 TTACCAAGGGTCACCCTGCTAGG - Intronic
1073192733 10:101663207-101663229 TAACCTAGGCTGTCCCTGGTTGG - Intronic
1075095614 10:119468899-119468921 TACCCAAGGCAGAGCCTGGAAGG + Intergenic
1077155539 11:1089345-1089367 TCCCCAAGGTTGGCCCTGCCGGG + Intergenic
1077410869 11:2403345-2403367 TTCCCAAGGCCGCCCCTGCCTGG - Exonic
1078460843 11:11514276-11514298 TGCCCCAGGCTGGCCCTGCAGGG + Intronic
1078804215 11:14680337-14680359 TAACCAGGCCTGACCCTGCTTGG - Intronic
1080050939 11:27858309-27858331 TACCCATGCCTGACTGTGCTAGG + Intergenic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1085278731 11:75316433-75316455 TAGCCTAGGCTCACTCTGCTGGG - Intronic
1085323067 11:75586657-75586679 TACCCAGGGCTCAGCCTGCTGGG + Intergenic
1085530231 11:77188049-77188071 TACCTAAAGCTGACACTTCTAGG + Intronic
1085701830 11:78752435-78752457 TCCCTGAGGCTGACCCAGCTGGG + Intronic
1085757705 11:79215443-79215465 TACCCAAGAATGACCTTGATTGG + Intronic
1094229335 12:28085015-28085037 AAACCAAGGCTGAGCCTGCATGG - Intergenic
1096529594 12:52234383-52234405 AACTCAGGGCTGGCCCTGCTGGG + Intronic
1096574574 12:52544677-52544699 TAGCCACCGCTGACCATGCTGGG + Exonic
1097107781 12:56635391-56635413 AACTCAAGGCCGAGCCTGCTGGG + Intronic
1099689899 12:85938913-85938935 TCACCAAAGCTGACCCGGCTAGG + Intergenic
1100288050 12:93186552-93186574 CACCCAAGGCTAAGCCAGCTGGG - Intergenic
1103190314 12:118995684-118995706 TACCCCAAGCTGACCCAGTTAGG + Intronic
1104566026 12:129884746-129884768 TACCCAGGGATGACATTGCTGGG - Intronic
1106214787 13:27686395-27686417 TACCCAAGGCTGCCCACCCTAGG + Intergenic
1106684739 13:32046396-32046418 TACCCTAGCCTGATGCTGCTGGG + Intronic
1111187407 13:84756918-84756940 TAACCAAAGCTTATCCTGCTAGG - Intergenic
1113072762 13:106437769-106437791 TACACAAGGCAGACCCTCATGGG + Intergenic
1114462623 14:22897111-22897133 TTCCAAAGGCTGCCCCTTCTAGG - Intergenic
1122144714 14:99682849-99682871 TAACTCAGGCTGGCCCTGCTGGG - Intergenic
1122470412 14:101962303-101962325 CACCCCAAGCTGACCCTGGTGGG - Intergenic
1122939180 14:104973630-104973652 TACCCCCAGCTGCCCCTGCTTGG + Intronic
1124093547 15:26628594-26628616 TACCCAAGACTGGCCCTCCAGGG - Intronic
1126097880 15:45102023-45102045 TACCCAAGCCTGACCTTGCTGGG - Intronic
1126373168 15:47968057-47968079 CAAAGAAGGCTGACCCTGCTTGG + Intergenic
1128036472 15:64530909-64530931 TACCCAAGTCTCATCCTGCAAGG - Intronic
1130910735 15:88269247-88269269 TAACCAAGTCTGGTCCTGCTGGG + Intergenic
1132730076 16:1356775-1356797 TGCCCCAGGCAGACACTGCTTGG - Intronic
1132736489 16:1388507-1388529 GACCCCATGCTGACCCTGCCCGG + Intronic
1133022067 16:2971150-2971172 TCCCTAGGGCTGGCCCTGCTGGG + Exonic
1133861585 16:9600146-9600168 TAACCAGGCCTGACCCTGCTTGG - Intergenic
1133862898 16:9613119-9613141 TACCCTAGGCTTACTCTACTGGG - Intergenic
1133921606 16:10158398-10158420 TACCCAAGAGTGAAACTGCTGGG - Intronic
1134834178 16:17347406-17347428 TACTCCAAGCTGACCCTGCCTGG + Intronic
1140410107 16:74736239-74736261 TCCCCAAGGCTGTCCATACTGGG - Intronic
1141935574 16:87235994-87236016 GACCCTAGGCTGGGCCTGCTTGG + Intronic
1143017047 17:3896428-3896450 CACCCAGCACTGACCCTGCTGGG + Intergenic
1146537923 17:33669134-33669156 TACCCAAGGATGACCCTCTAGGG - Intronic
1150143715 17:62750901-62750923 TACCCAAGTGAGACCCTGCGGGG - Intronic
1151096278 17:71502958-71502980 TACCCACACCTGACCATGCTGGG + Intergenic
1151519049 17:74615361-74615383 TGCCCAAGGGTGATCCTCCTGGG - Intronic
1151939220 17:77282110-77282132 TACTTAAGGCGGGCCCTGCTAGG - Intronic
1160739600 19:679866-679888 CACCCCAGGCTGACGCAGCTGGG + Intronic
1161031404 19:2059466-2059488 GGCCCATGGCTGACCCTGCAAGG - Intergenic
1163142393 19:15358636-15358658 AACCCAAGGCTAGCCCTACTCGG - Intronic
1165899565 19:39162776-39162798 TACCAAGGGCTGACTCTGCTGGG - Intronic
925277512 2:2660977-2660999 TTCCTAAGGCCGACCCTGCTTGG - Intergenic
925987035 2:9225025-9225047 TACCCAGGGTTGTCCCTGTTTGG + Intronic
928242952 2:29602322-29602344 TCCCCAGGCCTGACCCTGCTGGG - Intronic
930713308 2:54569837-54569859 TTTACAAGGCTCACCCTGCTGGG - Intronic
932414418 2:71565027-71565049 TCAGCAAGGCTGCCCCTGCTTGG + Intronic
934649577 2:96083335-96083357 AGCCCAAGGCAGAGCCTGCTCGG + Intergenic
936235099 2:110735644-110735666 CTCCCAAGGATGAGCCTGCTGGG + Intronic
942710413 2:178828560-178828582 AATCAAAGGCTGACCCTGCAGGG + Intronic
944423298 2:199553903-199553925 TACCTAAGGCTGACAATACTGGG + Intergenic
947820406 2:233065024-233065046 TATCCAAGGCTGACTGTGCCGGG + Intronic
1169383220 20:5126862-5126884 TAGGGAAGGCTGACCCCGCTCGG + Exonic
1171725879 20:28620551-28620573 CACCCTAAGCTGGCCCTGCTTGG - Intergenic
1173878698 20:46394163-46394185 TGCCCCAGCTTGACCCTGCTTGG - Intronic
1178640974 21:34344587-34344609 TGCTCAAGGCTCTCCCTGCTGGG + Intergenic
1180093292 21:45543113-45543135 TCCCCCGGGCTGTCCCTGCTGGG - Intronic
1180859751 22:19071033-19071055 TACCAAAGGCTGGCCCTCCGCGG - Intronic
1181023002 22:20113278-20113300 TCCCCAGGGCTGGCCCTGCTGGG - Intronic
1181678207 22:24471735-24471757 GGCCTAAGGCTGAGCCTGCTGGG + Intergenic
1182061164 22:27398884-27398906 TACCCAAGGGTTGCACTGCTGGG + Intergenic
1183062963 22:35346866-35346888 TGCCCCAGGCTGACCGTACTGGG + Intronic
1185003538 22:48261892-48261914 TAGCCAAGGCTTCTCCTGCTGGG - Intergenic
950525171 3:13519025-13519047 TCCCCGAGGCTGACCCTGGAGGG + Intergenic
953996761 3:47525791-47525813 TACCCAAGGCTGTGCCCTCTGGG + Intergenic
954135333 3:48579716-48579738 TGCCCAAGGTAGAACCTGCTGGG + Intronic
955138682 3:56247016-56247038 TACCCAAGGCAGTGACTGCTTGG - Intronic
955340477 3:58121495-58121517 AAGCAAAGGCTGACCTTGCTGGG - Exonic
956080137 3:65549068-65549090 CAGCCAAGGCGGCCCCTGCTCGG + Intronic
957149168 3:76463107-76463129 TATCCAAGGCTGCTCCCGCTGGG + Intronic
958435167 3:94087575-94087597 TAACTAAGGATGACCCAGCTTGG + Intronic
961043254 3:123692327-123692349 TCCTCACGGCTGACCCTGCTGGG + Intronic
961163507 3:124749070-124749092 TCCCCAAGTCTCACCCTGCAGGG - Intergenic
962968474 3:140376325-140376347 TACTCAAGGCTGCCCCTTCTAGG + Intronic
963201599 3:142591718-142591740 TAACCAGGTCTGACCCTGCTTGG + Intergenic
965300719 3:167001930-167001952 GCCCCAAGGCTGAACCTGGTTGG - Intergenic
966915448 3:184581938-184581960 TACCCCAGCCTGACCCTGCCAGG - Exonic
968663300 4:1807675-1807697 CACCCAAAGCTGAGCCTGCAGGG + Exonic
976092284 4:81471437-81471459 AACCCAAGCCTGGCCCTGCCCGG + Intronic
977129812 4:93221952-93221974 TATCCAAACCTGACACTGCTGGG - Intronic
978703595 4:111678258-111678280 TAACCAAGCCTGACAGTGCTAGG + Intergenic
980456979 4:133056902-133056924 TACCCAGGGTTCAGCCTGCTGGG + Intergenic
985967937 5:3351918-3351940 AACCTGAGGCTGCCCCTGCTTGG - Intergenic
987318972 5:16749936-16749958 TCCCCAAGGGTGTCCCTGCCTGG - Intronic
987849502 5:23332260-23332282 TAGCCAAGGATGACCCTTCTAGG - Intergenic
999242465 5:150135928-150135950 CTCCCAAGGCTGAGCCTGCGAGG + Intronic
999697940 5:154202849-154202871 CACCCCAGGCTGACTCTGCTGGG - Intronic
1002435773 5:179229908-179229930 TTGCCAAGGCTTACCCTCCTTGG + Intronic
1006152814 6:31998356-31998378 TCCCCAAGGCTGATCTGGCTGGG - Intronic
1006159122 6:32031093-32031115 TCCCCAAGGCTGATCTGGCTGGG - Intronic
1009651452 6:66481481-66481503 GACCGAAGGCTCACCCAGCTTGG + Intergenic
1010168685 6:72948383-72948405 TACTCAATGCTCACTCTGCTTGG - Intronic
1013664968 6:112338492-112338514 CACCCAAGGCTGGCCCAGTTAGG + Intergenic
1017962283 6:159233006-159233028 CGCCCAATGCTGAACCTGCTTGG - Exonic
1020062223 7:5161028-5161050 TAACCACAGCTGAACCTGCTGGG + Intergenic
1020165922 7:5807649-5807671 TAACCACAGCTGAACCTGCTGGG - Intergenic
1022505574 7:30907122-30907144 TACCCCAGGCTGGCCGTGCCTGG - Intergenic
1023927288 7:44678707-44678729 GACCCCACACTGACCCTGCTGGG - Intronic
1023986511 7:45100246-45100268 TCCTCAAGGGTGACCCTTCTTGG + Exonic
1026109647 7:67449042-67449064 CACCCAAAGCAGACCCTGATGGG - Intergenic
1026727362 7:72879877-72879899 AACCCAAGACTTACCCTCCTGGG - Exonic
1027116493 7:75485850-75485872 AACCCAAGACTTACCCTCCTGGG + Exonic
1027135033 7:75617907-75617929 TACCCAAGGCTGCGCTTTCTAGG - Intronic
1027275333 7:76549853-76549875 AACCCAAGACTTACCCTCCTGGG - Intergenic
1028979714 7:96954030-96954052 TTCCTAAGGCTGGCCCTGCTAGG + Intergenic
1029109816 7:98207250-98207272 TACCCCAGGCGGCCCCTGCACGG - Exonic
1029721044 7:102364403-102364425 AACCCAAGACTTACCCTCCTGGG - Exonic
1031895787 7:127347036-127347058 TTCCCAAGGCATACACTGCTGGG - Intronic
1033384981 7:140864547-140864569 TCCCCAGGGCTGAGCCTTCTTGG - Intronic
1037911080 8:22743940-22743962 CAGCCAAGCCTGACCCTGTTTGG + Intronic
1037952868 8:23030066-23030088 TCCCCAAGGCCCAGCCTGCTGGG + Intronic
1040311240 8:46237918-46237940 TCCCCAGGGCTGTCCCTGGTGGG + Intergenic
1040721765 8:50333118-50333140 TACTCAAGACTCAGCCTGCTGGG + Intronic
1046383482 8:113479828-113479850 TAACCAGGCCTGACCCTGCTTGG + Intergenic
1048200848 8:132372799-132372821 TACCTGAGGCCTACCCTGCTGGG - Intronic
1049340298 8:142108822-142108844 GGCCCGAGGCTGACCCTGCTGGG + Intergenic
1049805214 8:144535710-144535732 CACCCCAGCCTGAGCCTGCTTGG + Intronic
1051730102 9:20132181-20132203 TAACCAAGGAGGACCCTCCTTGG - Intergenic
1057314903 9:93961692-93961714 TACCAGAGGCTGATCCTGCCTGG - Intergenic
1058219969 9:102286530-102286552 TACCCAAGGATGAAACTGGTAGG + Intergenic
1058617205 9:106843793-106843815 TAACCAGACCTGACCCTGCTTGG + Intergenic
1058711395 9:107682247-107682269 TTCCCAAGGCTGGTCCTGCTGGG - Intergenic
1058738459 9:107918908-107918930 TCACCAAGCCTGACCCTGCGTGG + Intergenic
1061060327 9:128246968-128246990 GACCCAAGGCTGACTCTAGTGGG + Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1192698431 X:73443251-73443273 TACCCAAGGCAGACACTATTAGG - Intergenic
1194319125 X:92421622-92421644 TACCCAATGATGAGACTGCTGGG + Intronic
1199293293 X:146129310-146129332 TAACCAAAGCTTAACCTGCTAGG - Intergenic
1199982281 X:152927740-152927762 TGCCCCTGCCTGACCCTGCTGGG + Intronic
1200627255 Y:5534711-5534733 TACCCAAGGATGAGACTGCTGGG + Intronic