ID: 919354018

View in Genome Browser
Species Human (GRCh38)
Location 1:196498428-196498450
Sequence CAGAATTAGAAGAAAGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 664
Summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 600}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919354018_919354022 -8 Left 919354018 1:196498428-196498450 CCTCCCTCTTTCTTCTAATTCTG 0: 1
1: 0
2: 4
3: 59
4: 600
Right 919354022 1:196498443-196498465 TAATTCTGCAATATTGGTCATGG 0: 1
1: 0
2: 0
3: 9
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919354018 Original CRISPR CAGAATTAGAAGAAAGAGGG AGG (reversed) Intronic
900304948 1:2001147-2001169 GAGCCTGAGAAGAAAGAGGGCGG + Intronic
901284552 1:8066704-8066726 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG + Intergenic
901941304 1:12664115-12664137 AAGAAGAAGAAGAAAGAGTGAGG + Intronic
902599912 1:17533945-17533967 AAGAAGAAGAAGAAAGTGGGTGG - Intergenic
902771119 1:18646249-18646271 CCTAATTTGAAGAGAGAGGGAGG - Intronic
902946001 1:19839532-19839554 CACATTTAGAAGAAAGAAGTTGG + Intergenic
903085637 1:20855530-20855552 AAGAATAAGAAGAAAGAGATTGG + Intronic
903411258 1:23145195-23145217 CAAAATTAAAAGAAATAGGCTGG - Intronic
903466770 1:23557367-23557389 CAAAGTTGGAAAAAAGAGGGAGG - Intergenic
904758418 1:32782904-32782926 CTGAGTAAGAAGAAAGAGGAAGG + Intronic
905540960 1:38760125-38760147 CAGCCTTAGCAGAAAGAGGCTGG - Intergenic
905575917 1:39044540-39044562 AAGAAGGAGAAGAAAGAAGGAGG + Intergenic
906092706 1:43196012-43196034 TAGAATTGGAAGAAAAAGGTTGG + Intronic
906232249 1:44173749-44173771 CAGAAAGAGAAAATAGAGGGAGG + Intergenic
906282453 1:44563515-44563537 GAGAATTTCAAGAACGAGGGAGG - Intronic
906922218 1:50076737-50076759 GAGAATGGGAAGAAAGAGAGAGG + Intronic
906977061 1:50587148-50587170 CAGGATTTGGAGAAAGAGGATGG - Intronic
907787286 1:57625240-57625262 CAGGAGTAGAAGAAGGAGGAGGG - Intronic
907894939 1:58679206-58679228 CAGAAATAGAAGAGAGTGAGTGG - Intronic
909377791 1:74960038-74960060 CAGAAGCAAAAGAAAGAGGGAGG - Intergenic
909600497 1:77456576-77456598 CAGACTTAAAAGAACGAGGATGG + Intronic
909960342 1:81832648-81832670 AAGAAAATGAAGAAAGAGGGTGG + Intronic
910774851 1:90864513-90864535 AAGAAGAAGAAGAAAGAAGGTGG - Intergenic
910912822 1:92255839-92255861 CACAATTAAAAGAAATAGAGAGG + Intronic
911284693 1:95975209-95975231 AAGAATGAGGAGAAGGAGGGTGG - Intergenic
911553427 1:99312734-99312756 CAGAAGTAGGAGTAGGAGGGAGG + Intergenic
911761334 1:101620842-101620864 CAGAAAAAGAAAAAAGAGAGTGG - Intergenic
912861443 1:113217401-113217423 CAGAAGCAGAAGAAAGCTGGTGG - Intergenic
912864533 1:113245602-113245624 CAGAATGTGGAGAAAGAGAGAGG - Intergenic
912919164 1:113848924-113848946 CAGAATTAGAGAAATGATGGTGG - Intronic
913046764 1:115080249-115080271 AAGAATTAGGAGAAAGACGATGG + Intronic
914409353 1:147410792-147410814 CAAAATTGGAAGATAGAAGGAGG - Intergenic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
915721871 1:157992040-157992062 CACAATTAGAAGACAGAGAAAGG - Intergenic
916058860 1:161085534-161085556 CAGATTTAGAGGGAAGGGGGTGG + Intronic
916127090 1:161581264-161581286 AAGACTGAGAGGAAAGAGGGTGG + Intergenic
916137010 1:161663068-161663090 AAGACTGAGAGGAAAGAGGGTGG + Intronic
916368192 1:164057778-164057800 ATGAATGAGAAGAAAGAGGAAGG - Intergenic
916422022 1:164646534-164646556 CACAATTAGAAGTAAGGGGTCGG - Intronic
917286752 1:173429285-173429307 AGGAAATACAAGAAAGAGGGGGG - Intergenic
917498117 1:175561039-175561061 CTGAATTAGAAGAACAAGGAAGG - Intronic
917792984 1:178511752-178511774 CAAAATTAGCAGAAGGAGGTGGG + Intergenic
919291519 1:195639509-195639531 AAGAAAAAGAAAAAAGAGGGAGG - Intergenic
919354018 1:196498428-196498450 CAGAATTAGAAGAAAGAGGGAGG - Intronic
920776563 1:208943786-208943808 GAGAAAGAGGAGAAAGAGGGTGG + Intergenic
921116888 1:212100361-212100383 GAGTATTTGAAGGAAGAGGGAGG - Exonic
921233214 1:213095251-213095273 CAGAGTAAAAAGAAAGAGAGAGG - Intronic
921479748 1:215650484-215650506 CAGAAGGATAAGAAAGATGGAGG + Intronic
922224790 1:223636930-223636952 CAGAAGTGGGAGAAAAAGGGGGG - Intronic
922338135 1:224634285-224634307 AAGAATAAGAAAAAAGAGGCCGG + Intronic
922365415 1:224858796-224858818 AAGAGTTACAAGAAAGAGAGAGG + Intergenic
922400408 1:225248385-225248407 CAAAATAAGATGGAAGAGGGGGG + Intronic
922842712 1:228656977-228656999 AAGAAATAGAAAAAAGAGGCTGG + Intergenic
923006285 1:230052670-230052692 GAGAATAAGAAGGAAGAGGTCGG - Intergenic
923650726 1:235870724-235870746 CAGAAATAGAACAAAGATTGTGG - Intronic
923703961 1:236327954-236327976 GAGAATTAGAAGAATGGAGGGGG + Intergenic
923828741 1:237529885-237529907 CAGAATTAGAAGAAGTTGGAGGG + Intronic
924066959 1:240233790-240233812 AAGAACTAGAAGCAAGAGGCAGG + Intronic
924119985 1:240787254-240787276 CACCATTAGAAGAATGAGGGAGG - Intronic
1062922888 10:1293189-1293211 CAGGAATAGAAAAAAGAGGGAGG + Intronic
1063135960 10:3216572-3216594 CAGAAATGGAAGTGAGAGGGAGG + Intergenic
1063373637 10:5538517-5538539 CAGGAGTAGAAGAAACAGGCCGG - Intergenic
1063905805 10:10779001-10779023 CAGAAAAAGAACAAAGATGGGGG + Intergenic
1064044534 10:12000368-12000390 TAGAATTACATGAAATAGGGAGG - Intronic
1064216049 10:13401510-13401532 CAGAACAGGAAGAGAGAGGGTGG + Intergenic
1064850840 10:19707055-19707077 GAGAAGTAGAAGAAAGGAGGAGG - Intronic
1064865700 10:19877184-19877206 TAGAATGAGGAGAGAGAGGGAGG + Intronic
1065066096 10:21966667-21966689 AAGAAGAAGAAGAAAGAGGTGGG - Intronic
1065189495 10:23196851-23196873 CAGAAATTGAAGAGGGAGGGAGG - Intergenic
1065358538 10:24867250-24867272 CAGAGTTAAATGAAGGAGGGAGG - Intronic
1065623821 10:27610641-27610663 AAGAAGGAGAAGAAAGAAGGAGG - Intergenic
1066480611 10:35792178-35792200 AAGAATGAGAAGAGAAAGGGGGG + Intergenic
1067144893 10:43687835-43687857 CAGAAGTAGGAAGAAGAGGGAGG + Intergenic
1067485584 10:46646795-46646817 TAGAATTAGAAGAAGATGGGAGG - Intergenic
1067563333 10:47319536-47319558 CACAATTTGGAGGAAGAGGGGGG + Intergenic
1067609175 10:47694857-47694879 TAGAATTAGAAGAAGATGGGAGG + Intergenic
1067914660 10:50384432-50384454 GAGAAAGAGAGGAAAGAGGGAGG - Intronic
1068603459 10:58979492-58979514 CATAATTGTAAAAAAGAGGGAGG + Intergenic
1069415054 10:68191512-68191534 CAGAAATAGAAAAAACAGGCTGG - Intronic
1069514666 10:69068192-69068214 CTGCATTGGAAGCAAGAGGGAGG - Intergenic
1069606030 10:69739303-69739325 CAGCATGAGAAGGAAAAGGGAGG + Intergenic
1070166902 10:73905707-73905729 CAGAATAAGAAAGGAGAGGGTGG + Intergenic
1070354249 10:75624217-75624239 CAGAATTAGGAGAAAGACTAAGG + Intronic
1070506397 10:77117250-77117272 CAAAATTAGAGGAAACAGGCTGG + Intronic
1070835865 10:79446480-79446502 CAGAAATAGGAGAAGGGGGGGGG - Intergenic
1071120705 10:82274352-82274374 CAGAATTAGAAGAAGGTTGCAGG - Intronic
1071150635 10:82630195-82630217 CGGAATAAGAAGAAAATGGGAGG + Intronic
1071591809 10:86882069-86882091 CATAATTATATGAAAGGGGGAGG + Intronic
1071624763 10:87156503-87156525 TAGAATTAGAAGAAGATGGGAGG + Intronic
1073114052 10:101080985-101081007 AGGAATGAGAAGGAAGAGGGAGG + Intergenic
1073784674 10:106875858-106875880 CAGAAGTAGAAAAAGTAGGGAGG + Intronic
1073812855 10:107169795-107169817 CAGAATTGGACAAAACAGGGGGG - Intergenic
1073946983 10:108762371-108762393 CCAAATTAGAAATAAGAGGGAGG + Intergenic
1074058098 10:109940876-109940898 CAGAATTAGATAGAAGAGGAGGG - Intergenic
1074402550 10:113153876-113153898 AAGTATGAGAAGAAAGAGGAAGG - Intronic
1074539645 10:114353834-114353856 CAGCCTTAGAAAAAAAAGGGTGG + Intronic
1074836573 10:117301848-117301870 GGGAATTAGAGGAAAAAGGGAGG - Intronic
1075696113 10:124436729-124436751 CAGAATGAGATGAAGGAAGGAGG - Intergenic
1075898716 10:126020691-126020713 TAGAAATAGAAGAAAAACGGCGG + Intronic
1076058612 10:127395660-127395682 CAGACTTAGAGGAGGGAGGGTGG + Intronic
1077618666 11:3698847-3698869 GAGAATTAGAAGACATAGTGCGG - Intronic
1077789985 11:5428861-5428883 CAGGATTAGAAATAAGAGAGGGG + Intronic
1078292678 11:10028920-10028942 CAGAGGTAGAAGAATGAAGGAGG + Intronic
1079489573 11:20972525-20972547 TAGAATTAGAAACTAGAGGGAGG + Intronic
1079959083 11:26900506-26900528 AAGAAGTAGAAGAAAGAGGTAGG - Intergenic
1081003947 11:37710273-37710295 CAGAACTAGCAAAAAGGGGGAGG + Intergenic
1081385857 11:42472143-42472165 CAGATATTGAAGAAAGAGGTAGG - Intergenic
1082621466 11:55428412-55428434 CAGAATTATAGGAAAAAAGGTGG - Intergenic
1082781004 11:57287347-57287369 CAGAATTACCAGAAACGGGGTGG + Intergenic
1082920797 11:58491317-58491339 CAGAATTTGAGGAGGGAGGGAGG + Intergenic
1083768616 11:64854180-64854202 CAGCCTTAAAAGAAAGATGGTGG + Exonic
1085807668 11:79651109-79651131 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
1086259616 11:84923432-84923454 AAGAAGAAGAAGAAGGAGGGGGG + Intronic
1086377854 11:86219376-86219398 AAGAAATAGAAGAAAGAGATGGG + Intergenic
1086810697 11:91306813-91306835 CAGAATTAGAGGACAGAGTTAGG + Intergenic
1087982729 11:104636298-104636320 CAAAACTAGAAGGAAGAAGGAGG - Intergenic
1088302339 11:108372786-108372808 GAGAATTACAAGAAAGATGCCGG + Intronic
1089330655 11:117686683-117686705 CAGAATTTTAAGGAAGAGGCAGG + Intronic
1089484834 11:118837222-118837244 AAGAATAAGAAGAATGAGAGAGG + Intergenic
1089575085 11:119436491-119436513 CAGGAGTACAAGAAAGAGAGCGG + Intergenic
1089851191 11:121498027-121498049 CAGAATGAGAAGAGAGATGTGGG + Intronic
1090174223 11:124633437-124633459 CAGAAGTAGAAGAATGGGGATGG + Exonic
1090701940 11:129304328-129304350 AAGAATGAGAAGGAAGAGGCCGG + Intergenic
1090889740 11:130913256-130913278 CAGAATTAGAACAAAAAGGCAGG + Intronic
1091296963 11:134480679-134480701 CAGGATTAGAACAAAGAAGGAGG + Intergenic
1091995706 12:4992097-4992119 CAGAAAAAAAAAAAAGAGGGGGG - Intergenic
1092167837 12:6353972-6353994 CAGAGATAGAAGAGAGAGGGAGG + Intronic
1093110186 12:15142687-15142709 AAGAAAGAGAAGAGAGAGGGGGG + Intronic
1094070294 12:26405149-26405171 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1094129877 12:27063392-27063414 GAGAAGGAGAAGAAAGAAGGGGG - Intronic
1094242354 12:28242892-28242914 CAGAAGTAGGAGCAAGAGGGGGG - Intronic
1094324898 12:29226951-29226973 CACAATGAGAAGGAAGAAGGTGG + Intronic
1094337139 12:29372382-29372404 AAGAAGAAGAAGAAAGAAGGTGG + Intronic
1094408831 12:30148222-30148244 CAGAATTGGATGACAGATGGTGG + Intergenic
1094584699 12:31767408-31767430 AAAAATTAAAAGAAAGAGGAGGG + Intergenic
1094761708 12:33540417-33540439 CAGAATAGGAAGAAAGCTGGTGG + Intergenic
1095175563 12:39088421-39088443 GAGATTTAGGAGGAAGAGGGTGG - Intergenic
1095266682 12:40167775-40167797 AAGAATTAACAGAAAGAGAGAGG + Intergenic
1095333230 12:40994183-40994205 CAAAATTCCAAGAAAGAAGGAGG + Intronic
1095429646 12:42119427-42119449 CAGAAAGAGAAGAAAGAGAAAGG + Intronic
1097616587 12:61891344-61891366 CAGAATCAGAAGAAAAAGAAGGG + Intronic
1097924614 12:65113431-65113453 TAGAATCAGAATAAATAGGGAGG + Intronic
1098222600 12:68285836-68285858 CAGATTTGGGAGAAAGAGGTGGG + Intronic
1098237899 12:68435625-68435647 GAGAAGAAGAAGTAAGAGGGAGG + Intergenic
1098906220 12:76165385-76165407 CAGAATTAGAAAAAACTTGGGGG - Intergenic
1099138400 12:78938184-78938206 AAGAAATAGAAGGAAAAGGGTGG - Intronic
1099578670 12:84412600-84412622 TAGAGTTAGAAAAAAGAGGTTGG + Intergenic
1100473119 12:94911595-94911617 CAGCATGAGATGAAAGATGGGGG - Intronic
1100523748 12:95400819-95400841 CAGAAAGAGAAGGCAGAGGGTGG - Intergenic
1100871847 12:98917857-98917879 AAGAATTAAAAGAAAGAATGAGG - Intronic
1101212547 12:102549006-102549028 GAGAATCAGAGGAGAGAGGGAGG + Intergenic
1102194725 12:111016900-111016922 CAGAGGTAAAAGAGAGAGGGAGG - Intergenic
1102238553 12:111309611-111309633 CAGAAATAGAGGAAGGAAGGAGG - Intronic
1103044826 12:117727395-117727417 CAGAAAAAGAAGAAAGAAGAAGG + Intronic
1104379110 12:128291517-128291539 CAGAAATAGGTGAAAGGGGGAGG + Intronic
1105822344 13:24090687-24090709 AAGAATTAGAAGAAAGTGAAAGG - Intronic
1106558371 13:30829085-30829107 CAGGTTTAGAAGAAAGCAGGAGG - Intergenic
1106883346 13:34156192-34156214 CAGAGCTAGAAGAAAGAGACCGG - Intergenic
1107264290 13:38533872-38533894 CAGAAGAAGAAGAAAGGGGGAGG + Intergenic
1107330413 13:39294159-39294181 CAGAATTAGAAGAAATGGAAAGG + Intergenic
1107802850 13:44126613-44126635 GAGAAGTACAAGAAAGAAGGTGG + Intergenic
1107956206 13:45514532-45514554 CAGAATTAGATAAAAGAGGATGG - Intronic
1108304029 13:49113061-49113083 GAGAAATAGGAGAAAGGGGGAGG - Intronic
1108516919 13:51212128-51212150 GAGAATGAGAAGACAAAGGGGGG + Intergenic
1108801436 13:54100982-54101004 CAGAATGAGGAAAAAAAGGGGGG - Intergenic
1108851128 13:54730671-54730693 TAGAATAAAAAGACAGAGGGAGG - Intergenic
1109034068 13:57232108-57232130 CCCAATTAAAAGATAGAGGGTGG + Intergenic
1109418635 13:62079164-62079186 CAGAATAAAAAGAAAGAGAATGG - Intergenic
1110150629 13:72248718-72248740 CAGAATAAGAGGAAAAAGGATGG + Intergenic
1111299586 13:86330344-86330366 CAGAAATAGAAGAGAGAGAATGG - Intergenic
1111680978 13:91440986-91441008 AAGAACTAGAAGACAGAGGTTGG - Intronic
1111767712 13:92554279-92554301 CTGAATGAAAAGACAGAGGGTGG - Intronic
1111917697 13:94378456-94378478 TAAAATTAGACAAAAGAGGGAGG - Intronic
1112983760 13:105420658-105420680 GAGCATTAGAACATAGAGGGGGG + Intergenic
1113110771 13:106821156-106821178 CAGAATGTGAAGAAAAAGGGGGG - Intergenic
1113115070 13:106866717-106866739 AAGAATGAGAAGAAAGTGGCCGG + Intergenic
1113258606 13:108534779-108534801 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
1114158897 14:20140407-20140429 CAGAATTAGCAGGAAGAGAATGG + Intergenic
1114525325 14:23364494-23364516 AAGAAAGAGAAGACAGAGGGAGG - Intronic
1114684398 14:24514272-24514294 TAGAAGTAGAAGAAAGGGGATGG + Intergenic
1116214054 14:41987810-41987832 CAGAAATAGAAGAGAGTGGTGGG - Intergenic
1116321449 14:43470565-43470587 CTAAATTAGAAAAAAGGGGGTGG - Intergenic
1117212910 14:53519831-53519853 AAGAACGAGAAGAAAGAGAGGGG + Intergenic
1117546172 14:56796309-56796331 AAGAATTAAAAGAAAAGGGGTGG + Intergenic
1118043006 14:61937758-61937780 GAGAACTAGAGGAAAGAGGAAGG + Intergenic
1118638460 14:67769745-67769767 CAGGAGGAGAAGAAAGAGGGAGG + Intronic
1118677150 14:68199636-68199658 CGGAATGAGATGAAGGAGGGAGG - Intronic
1118807677 14:69251778-69251800 CTGAGGTAGAAGAAAGAGGAAGG + Intergenic
1118882663 14:69842555-69842577 TGGAACTAGAACAAAGAGGGTGG - Intergenic
1120673985 14:87397479-87397501 CAGAATTAGAAGGAGGAAGGGGG - Intergenic
1121058686 14:90883228-90883250 CAGAAGGAGAAGAAAGAGAAAGG - Intronic
1121067201 14:90979289-90979311 AAGAAGTGGAAGGAAGAGGGAGG + Intronic
1121604934 14:95233746-95233768 CAGAATTGGAACAAGGCGGGGGG + Intronic
1121676729 14:95759579-95759601 CAGAGTGAGAGGAGAGAGGGGGG - Intergenic
1121926837 14:97934712-97934734 CTGACTTTGAAGAAAGAGGAAGG + Intronic
1122080582 14:99264290-99264312 AAGAATTAAAAAAAAGGGGGGGG - Intronic
1122680148 14:103454036-103454058 CAGGTTTAGTAGAAAGAGGATGG + Intronic
1202901220 14_GL000194v1_random:41162-41184 CAGATTTAGATGATAGAGTGAGG + Intergenic
1123574324 15:21651728-21651750 CTGAAACAGAAGAAAGAGTGTGG + Intergenic
1123610939 15:22094315-22094337 CTGAAACAGAAGAAAGAGTGTGG + Intergenic
1125000818 15:34768437-34768459 CAGAACTTCAAGAAACAGGGAGG - Intergenic
1125311483 15:38383532-38383554 CTGAATTAGAAGAAAGAAGTTGG + Intergenic
1126426223 15:48529451-48529473 CAGAATGGGAGGAAAGAGTGTGG + Intronic
1126506656 15:49412710-49412732 CTTAATTAGAAAAATGAGGGAGG + Intronic
1126583831 15:50263847-50263869 CAGAATTTAAAAAAAGAGTGAGG + Intronic
1126849838 15:52790220-52790242 CAGAATTTTAAGAAAGAGAGGGG - Intronic
1127240113 15:57104266-57104288 CATAATTGGAAGATAGAGGAAGG + Intronic
1127286142 15:57535436-57535458 AAGAATTACTGGAAAGAGGGTGG + Intronic
1127850072 15:62904585-62904607 CAGAGTTCGAAAAAATAGGGTGG + Intergenic
1128690888 15:69723999-69724021 CAGAATTACAAGGTGGAGGGTGG + Intergenic
1128896415 15:71377599-71377621 GAGGATAAGGAGAAAGAGGGCGG + Intronic
1130433216 15:83869999-83870021 AAGAAAGAAAAGAAAGAGGGAGG + Intronic
1130795137 15:87199860-87199882 AAGAAAAAGAAGAAAGAGGAAGG + Intergenic
1131018708 15:89079775-89079797 CTGAGCTAGAAGAAGGAGGGAGG - Intergenic
1131233079 15:90673631-90673653 AAGACTCTGAAGAAAGAGGGAGG - Intergenic
1131354739 15:91734914-91734936 AAGAAGAGGAAGAAAGAGGGAGG + Intergenic
1131424628 15:92335422-92335444 CAGAAAAAGAAGAGAGAGGGAGG - Intergenic
1131661295 15:94520593-94520615 TAGAATTTGAAAAAAGAGGAGGG - Intergenic
1131827307 15:96331753-96331775 CAGAACGTGGAGAAAGAGGGAGG - Exonic
1202983188 15_KI270727v1_random:386071-386093 CTGAAACAGAAGAAAGAGTGTGG + Intergenic
1133000532 16:2849160-2849182 CAGGACTAGAAGAAGGAGGAAGG + Intergenic
1133144992 16:3778114-3778136 AAGAACTAGAAGAAAAACGGAGG - Exonic
1133191970 16:4140488-4140510 CAGAAGCAGGAGAAAGAGAGAGG - Intergenic
1134060005 16:11193696-11193718 CAGGATGAGGAGGAAGAGGGAGG - Intergenic
1134097645 16:11429266-11429288 CAGGATTAAGAGAAAGAGGGGGG - Intronic
1134324287 16:13192883-13192905 GAGAAGAAGAAGAAAGAAGGAGG + Intronic
1135521429 16:23181686-23181708 GAGAGAAAGAAGAAAGAGGGAGG + Intergenic
1135631663 16:24040285-24040307 AAGGATTAAAAGAAAGGGGGAGG - Intronic
1135693873 16:24569498-24569520 CAGAAAAAGAAGAAAAGGGGAGG + Exonic
1136004905 16:27322733-27322755 AAGTATTAGAAGAGAGAAGGTGG - Intronic
1136014173 16:27384173-27384195 CAGAATTGGCTGAAAGAGGAAGG - Intergenic
1136252440 16:29014704-29014726 CAGAAGCAGAATAAAGAGGTGGG - Intergenic
1136574398 16:31114916-31114938 AAGAAAAAGAAAAAAGAGGGAGG - Intergenic
1137246163 16:46707069-46707091 CAGAATTAGGAGAGAGGTGGAGG + Exonic
1137758673 16:50922847-50922869 CAGAGTGGGAAGGAAGAGGGTGG + Intergenic
1137820391 16:51439125-51439147 GAGAAAAAGAAAAAAGAGGGAGG + Intergenic
1139065917 16:63314423-63314445 AAGACTCAGAAGATAGAGGGTGG + Intergenic
1139239514 16:65376611-65376633 CAGAGTCTAAAGAAAGAGGGAGG + Intergenic
1139394076 16:66626132-66626154 CAGAATAAAAAGAAAAAGGGAGG + Intronic
1139402481 16:66694041-66694063 AAGAGTGAGAAGAAAGAGAGAGG + Intronic
1139457614 16:67094918-67094940 CAGAATTTTAAGAAAGAGGCCGG + Intronic
1139935187 16:70565338-70565360 CAGAATAAGAAGCAAGAGTAAGG - Intronic
1140837790 16:78811488-78811510 AAGAAAGAAAAGAAAGAGGGAGG - Intronic
1141033800 16:80611268-80611290 CAGTATTTGAAGAAAGGGAGAGG + Intronic
1142423440 16:89987545-89987567 CACATTTAAAAGAAAGAGGCCGG + Intergenic
1142561300 17:811090-811112 CAGAAGAGGAAGAAAGAAGGAGG + Intronic
1143332473 17:6147921-6147943 CAGAATAAAAAGAAATGGGGAGG - Intergenic
1143711756 17:8740603-8740625 CAGAGGTAGGAGAGAGAGGGAGG + Intronic
1143754010 17:9053293-9053315 CAGTGTTGGAAGAAAGAGAGCGG - Intronic
1144213566 17:13035123-13035145 CAGCATTAGATGAAAGAGAGAGG + Intergenic
1144497744 17:15759272-15759294 GTGTATTTGAAGAAAGAGGGTGG - Intergenic
1144629542 17:16863760-16863782 GTGTATTTGAAGAAAGAGGGTGG - Intergenic
1144651887 17:17012357-17012379 GTGTATTGGAAGAAAGAGGGTGG + Intergenic
1145121427 17:20263571-20263593 AAGAATAAGAAGTCAGAGGGAGG + Intronic
1145161113 17:20574322-20574344 GTGTATTGGAAGAAAGAGGGTGG - Intergenic
1145203021 17:20963724-20963746 AAGAATAAGAAGCCAGAGGGAGG + Intergenic
1146090395 17:29871851-29871873 CAGAATTTAAAGAAATAGAGAGG + Intronic
1148208127 17:45792270-45792292 CAGAGTTGGCAGAAAGAGGAAGG - Intronic
1148513580 17:48194752-48194774 TTGAATTAAAAGGAAGAGGGAGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148972777 17:51498815-51498837 CTTAATAAGAAGGAAGAGGGAGG - Intergenic
1149081280 17:52660544-52660566 CAGAAGGAGAAGGAAGAGGTAGG + Intergenic
1149176345 17:53876402-53876424 CAGAATCAAAAGAAAGTGGTTGG - Intergenic
1149376982 17:56054005-56054027 GAGAATCAGAAGAGGGAGGGAGG - Intergenic
1150051897 17:61972380-61972402 CAAAATTAAATGAAAAAGGGAGG - Intronic
1150772027 17:68050365-68050387 CAGAAAGAGAAGAAGGAAGGAGG - Intergenic
1151169907 17:72237305-72237327 CAGAATCAAAAGAGAGAAGGAGG + Intergenic
1151530277 17:74699831-74699853 CAGAATTTTGAGAAAGAGAGGGG - Intronic
1151617311 17:75221945-75221967 AAGAAATAGAAGAATGTGGGAGG + Intronic
1152384883 17:79966504-79966526 AAGAATTAGAAGAGAGAGAGAGG - Intronic
1153606742 18:6841276-6841298 AAGAATAAGAAGGAATAGGGAGG - Intronic
1155463356 18:26108585-26108607 CAGAATTAGAAAACAGATGGTGG - Intergenic
1156228333 18:35130557-35130579 CAGAATTATTAGAAGGAGAGAGG + Intronic
1156710572 18:39939544-39939566 CACAATGTGAAGAAAGAGTGTGG + Intergenic
1156965380 18:43085049-43085071 TAGAATGAGAAGGAAGCGGGAGG + Intronic
1157158852 18:45293984-45294006 CAGAATTTAAAGAAAGTGGGTGG + Intronic
1157419253 18:47531625-47531647 CAGAAAGAGAAGGAAGATGGGGG + Intergenic
1158109435 18:53924211-53924233 CAGAATAAGAGGCAAGAAGGGGG + Intergenic
1158276071 18:55768930-55768952 GAGAATGAAAAGAAAGATGGTGG - Intergenic
1159162661 18:64663172-64663194 GAGAATTAAAAAAAAGGGGGGGG - Intergenic
1159172635 18:64791341-64791363 AAGGATGAGAAGAAAGAGCGTGG - Intergenic
1159642106 18:70875807-70875829 CAGAATTTAAAGTTAGAGGGAGG + Intergenic
1160087802 18:75794834-75794856 CACAACTAGAAGAAAGGGGCTGG + Intergenic
1160843840 19:1158071-1158093 CAGGCTCAGAAGAAAGAGGCGGG - Intronic
1161659126 19:5535271-5535293 CAAATTTGGAAGAGAGAGGGAGG - Intergenic
1161935375 19:7368625-7368647 CAGATGCAGGAGAAAGAGGGAGG + Intronic
1163150635 19:15411282-15411304 CAGATTTAGAACAGGGAGGGGGG - Intronic
1163176747 19:15569554-15569576 GAGAGGCAGAAGAAAGAGGGAGG + Intergenic
1164110383 19:22151445-22151467 CACAATTAAAAGAAATAGAGAGG + Intergenic
1164729003 19:30487549-30487571 CAAAAGAAAAAGAAAGAGGGAGG - Intronic
1165163647 19:33834281-33834303 CAGAATGAGAAAAGAGAGTGTGG + Intergenic
1165622629 19:37261026-37261048 CAGAAAGAGAGGAGAGAGGGAGG - Intergenic
1166491425 19:43263935-43263957 CAGAATTAGGAAAAATGGGGAGG + Intronic
1166793058 19:45409238-45409260 AAGAAGAAGAAGAAAGAGAGAGG + Exonic
1167012171 19:46815899-46815921 AAGAATTAGAAGGAACAGGGTGG + Intergenic
1167852914 19:52215671-52215693 CAGAATTAGGGGACAGAGCGTGG - Intronic
1168101541 19:54144099-54144121 CAGAAGGAGAAGGAAGAGGTTGG + Exonic
925326927 2:3030084-3030106 CAGAGGGAGAAGAAAGAGGCAGG + Intergenic
926417043 2:12659847-12659869 CAGAATGAGCAGAAACAGGTTGG - Intergenic
926512431 2:13799154-13799176 AAGAATTAAAAGAAATAGTGTGG - Intergenic
927329371 2:21843851-21843873 AGGAATTAAGAGAAAGAGGGTGG - Intergenic
927399211 2:22691270-22691292 CAGAAAAAGAAGAAAAAGGGAGG + Intergenic
927804353 2:26132764-26132786 CAGATTTAAAAAAAAGGGGGGGG - Intronic
928620786 2:33085733-33085755 CAGAATTTGGAGTTAGAGGGTGG - Intronic
929073469 2:38057792-38057814 CTGGATCAGAAGGAAGAGGGAGG - Intronic
929113913 2:38428485-38428507 AAAAAATAGAAGAAGGAGGGTGG - Intergenic
929904054 2:46030556-46030578 CAGAAGTAACAGCAAGAGGGAGG - Intronic
929959619 2:46486725-46486747 GAAAATCAGAAGAGAGAGGGAGG + Intergenic
930105822 2:47638556-47638578 CAGAATTACAAGAAATAAGATGG - Intergenic
930412242 2:51039735-51039757 GAGAACTAGAAGAAAAAGGCAGG - Intergenic
930544529 2:52749738-52749760 CAGAAATAAAAGAAAAAGGAAGG - Intergenic
931477377 2:62603017-62603039 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
931840358 2:66142006-66142028 CAGAATTAAAAGAACTAGAGAGG - Intergenic
933674759 2:85044812-85044834 CAGAAATAAAAGCAAGAGGCTGG - Intronic
934110428 2:88737069-88737091 CAGAATGAGAGGAAAGAAGAGGG - Intronic
934162198 2:89260484-89260506 CAGAATTAGAAGAAACAATTTGG + Intergenic
934205084 2:89921878-89921900 CAGAATTAGAAGAAACAATTTGG - Intergenic
934505563 2:94889927-94889949 CAGATTTAGATGATAGAGTGAGG - Intergenic
935212784 2:100952909-100952931 CAAATTTAAAAGAAAGAGTGCGG + Intronic
935384882 2:102489487-102489509 CTGAACTTGAAGAAAGATGGAGG - Intronic
935466604 2:103405799-103405821 CAGAATTTGAGGAAGGATGGAGG + Intergenic
935869946 2:107436916-107436938 AATAATTAGAAGACAGTGGGGGG - Intergenic
937110583 2:119364063-119364085 CAGAGATAGGAGAAAGGGGGAGG + Intronic
937441449 2:121919406-121919428 CAGAATTAGAAGAAACTAAGAGG + Intergenic
937630731 2:124098317-124098339 TAGGCTTAGAAGGAAGAGGGGGG + Intronic
937669973 2:124528125-124528147 CAGAACTGGAAGAATGAAGGAGG - Intronic
937689434 2:124738235-124738257 CAGAGTGAAAAGAAAGAGGGAGG - Intronic
937992356 2:127671730-127671752 CAGAAGTAGAAGAAAAAGGAAGG + Intronic
938412454 2:131076130-131076152 GAGAATGAGAAAAAAGAGGCTGG - Intronic
939007077 2:136801615-136801637 CTGTATTAGAAGAAAAATGGCGG + Intronic
939206449 2:139110648-139110670 CAAAATCAGTAGTAAGAGGGAGG - Intergenic
939553130 2:143640287-143640309 GGGAATCAGAAGGAAGAGGGTGG + Intronic
940164056 2:150748397-150748419 AAGAAAAAGAAGAAAGAGGAAGG - Intergenic
940545975 2:155085861-155085883 CAGACTCAGAAGGAGGAGGGTGG + Intergenic
940588067 2:155682087-155682109 CAGAATTAAAAGGAAAAGGAAGG + Intergenic
941262166 2:163311024-163311046 AATAATAAGAAGACAGAGGGAGG + Intergenic
941294030 2:163713830-163713852 CAGTATTAACACAAAGAGGGGGG + Intronic
941465733 2:165824339-165824361 CAGAATAAGAAGATGGAAGGAGG - Intergenic
941991457 2:171561242-171561264 CAGAATTAGAAGAAGGAAAAAGG - Intergenic
942305383 2:174601957-174601979 AAGAGGCAGAAGAAAGAGGGTGG + Intronic
942533688 2:176940212-176940234 CAGAATTAGAAGCCAGAGTCAGG - Intergenic
942838519 2:180331258-180331280 CAGACTAAGAAAAAAAAGGGAGG + Intergenic
942845488 2:180419562-180419584 GACTATTAGAAGAAAGAAGGTGG + Intergenic
944937457 2:204584078-204584100 CAGAATTAGATGCAAGGGTGAGG + Intronic
945002765 2:205369299-205369321 CTGAATTAGGAGAATAAGGGTGG - Intronic
945096833 2:206228497-206228519 GAGAGTTAGAGGAAAGGGGGTGG + Intergenic
945440908 2:209878279-209878301 CAGAAAGAGAAGACAGAGAGGGG + Intronic
945800718 2:214426352-214426374 CAGAGTTAGAAATAAGAGTGAGG + Intronic
945984760 2:216344695-216344717 CATAAGGAGATGAAAGAGGGAGG + Intronic
946027433 2:216680214-216680236 CAGTATTTGAAAAAAGAGGGAGG - Intronic
946572906 2:221043726-221043748 GAGATGTACAAGAAAGAGGGAGG - Intergenic
947048880 2:226019712-226019734 CAGAATGAGAACAAAGAGAAGGG + Intergenic
947959606 2:234224699-234224721 CAGAATCTGCAGAAAGAGAGGGG - Intergenic
948033136 2:234836088-234836110 GAGAACAAGAGGAAAGAGGGTGG - Intergenic
948187450 2:236032584-236032606 CATTATTAGAAAAGAGAGGGTGG + Intronic
948774088 2:240272210-240272232 CCAAATTTGAAGAAAGAGAGAGG - Intergenic
1168735071 20:127725-127747 CAGAAGGAGAAGAAAGAGAAAGG + Intergenic
1169112694 20:3044073-3044095 CAGAAGTGGAAGAAAGTTGGAGG - Intronic
1169603748 20:7291791-7291813 GAGAATTTCAAGAAAGAGGTGGG + Intergenic
1169765567 20:9144645-9144667 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1169876155 20:10299229-10299251 AAGTTTTAGAAGACAGAGGGTGG - Intronic
1170286760 20:14718368-14718390 CAGTATTAGAGGAAACAGTGTGG + Intronic
1170421022 20:16193431-16193453 CAAAGTAAGAAGAAAGAAGGGGG + Intergenic
1171100275 20:22376743-22376765 GATAAATAAAAGAAAGAGGGAGG + Intergenic
1171469000 20:25354921-25354943 CAGAAAGAGAAGAAAGAGATAGG - Intronic
1171500843 20:25591848-25591870 CAAAAGTAGAAGCAAGAGGAGGG - Intergenic
1171924210 20:31175642-31175664 CAGAATCAAAAGGAAGAGAGTGG + Intergenic
1173017636 20:39240044-39240066 CAGAATTAGACTAAAGACTGGGG - Intergenic
1173194440 20:40902733-40902755 CAGAATTAAAAGAAACAGGAGGG + Intergenic
1173500877 20:43552230-43552252 CAGAATAAAAAGAAAAAGAGAGG + Intronic
1173578066 20:44126125-44126147 CAGAAGAAAAAGAGAGAGGGAGG + Intronic
1173660869 20:44732726-44732748 GAGAGATAGAAGAAAGAGAGAGG - Intergenic
1174541681 20:51294647-51294669 CAGGGTTGGAAGAAAGAGGAAGG - Intergenic
1174727921 20:52883534-52883556 CACAATTAGAAAATAGAGGAGGG - Intergenic
1175040578 20:56046461-56046483 GAGACTCAGAAGAAAGAGGGTGG + Intergenic
1175376659 20:58531477-58531499 CAGAATGAGAAGACAGAATGAGG - Intergenic
1176620595 21:9055940-9055962 CAGATTTAGATGATAGAGTGAGG + Intergenic
1177094170 21:16810950-16810972 CAAAATTAGAACCAAGAGGGAGG - Intergenic
1177346649 21:19881911-19881933 CAAAGGTAGAAGAAAGAGAGTGG + Intergenic
1177480282 21:21677440-21677462 CAGAACCAGAAGAAAGAGACAGG + Intergenic
1178016124 21:28347593-28347615 GAGAAGGAGAAGAAAAAGGGAGG - Intergenic
1178806162 21:35841383-35841405 CAGAGTGAGAAGACAGAGTGTGG + Intronic
1179252523 21:39684281-39684303 CATAATTGGAAGGAAGTGGGTGG + Intergenic
1180207496 21:46270356-46270378 CAGAGTTGGAAGAAAGCAGGTGG - Intronic
1181149511 22:20873128-20873150 CAGAATTAAAACAAAGAGAGAGG - Intronic
1181323624 22:22027798-22027820 CAGAAGTAGCAGAAACAGGGTGG + Intergenic
1181817284 22:25448104-25448126 CAGAATGAGAAGAAGGAAAGCGG + Intergenic
1184929021 22:47666749-47666771 CAGAAGAAGAAGAAAAAAGGAGG - Intergenic
949277297 3:2299467-2299489 AAGATTCAGAAGAAAGAGGGTGG - Intronic
949890723 3:8731999-8732021 CTGGATAAGAAGAAAGAGGAAGG - Intronic
949994560 3:9606272-9606294 AAGAATAAAAAGAATGAGGGAGG - Intergenic
950212622 3:11135219-11135241 CAAAATTAGAAAGCAGAGGGAGG + Intergenic
950464832 3:13147317-13147339 CAGACTCAGAAGAGGGAGGGTGG - Intergenic
950845546 3:16012086-16012108 AAGAAGGAAAAGAAAGAGGGAGG + Intergenic
950960657 3:17102728-17102750 CAGAATTAGAAGAAAAAAAGAGG + Intergenic
952242113 3:31542113-31542135 CAAAAATACAAGAAAGTGGGTGG + Intronic
952493146 3:33891232-33891254 GAGACTCAGAAGAGAGAGGGTGG - Intergenic
953316000 3:41926511-41926533 CAGAAGTAGGCTAAAGAGGGTGG + Intronic
953385487 3:42503485-42503507 CAGAAGTGGGAGGAAGAGGGAGG - Intronic
955100843 3:55848312-55848334 AATAATTAGGAAAAAGAGGGAGG - Intronic
955425941 3:58790161-58790183 AATAATTAGAAGAAGGAGGAAGG - Intronic
955940425 3:64142168-64142190 CAGTGTCAGAAGAAAGATGGTGG - Intronic
956202630 3:66722314-66722336 AAGAAGAAGGAGAAAGAGGGAGG - Intergenic
957191103 3:77010885-77010907 AGGAAGGAGAAGAAAGAGGGAGG - Intronic
957221044 3:77382566-77382588 GAGACTCAGAAGAAAGAGGTTGG - Intronic
957397678 3:79663667-79663689 CAGAACTAGAAGAGAAAGGGTGG - Intronic
957617599 3:82551330-82551352 CAGACTTGGAAGATAGAGGAAGG - Intergenic
957743090 3:84299927-84299949 CAGAATACGAAGAATGGGGGTGG - Intergenic
957745058 3:84329838-84329860 CAGAATTAGAAGAAATATGATGG - Intergenic
959022888 3:101208082-101208104 CACTATTTGAGGAAAGAGGGTGG - Intergenic
959615136 3:108338812-108338834 CAGAATGAGATAAAACAGGGAGG + Intronic
960251195 3:115455963-115455985 CAGAATTAGAAGAACAAAGTTGG - Intergenic
960267831 3:115640978-115641000 GAGAAATAGAAGAAAGAAGAAGG - Intronic
960775132 3:121241698-121241720 AAGGAAGAGAAGAAAGAGGGTGG + Intronic
960812300 3:121636603-121636625 GAGAATCAGAGGATAGAGGGAGG + Intronic
961571636 3:127803404-127803426 GAGAATTAGAAGAAGCAGGTGGG - Intronic
961996733 3:131253372-131253394 CAGAATTAGGAGAAAGAAAGAGG + Intronic
962192761 3:133328669-133328691 CAGCATGAGATGAGAGAGGGTGG - Intronic
962230735 3:133663247-133663269 CTGAATTAGGAGAGAGAGAGTGG - Intergenic
962655078 3:137535505-137535527 CAGAATTAAGAGAGAGAGTGTGG - Intergenic
962832517 3:139157219-139157241 CAGAAATAGGAGAAAGGAGGTGG - Intronic
963511058 3:146250468-146250490 CAGAATTGGAAATAAGAGAGAGG + Intronic
963514762 3:146294041-146294063 AAGAATTTGAATCAAGAGGGAGG - Intergenic
963825567 3:149949628-149949650 CAGAAGGAGAAGAAAGAAAGGGG - Intronic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
965495581 3:169394642-169394664 CATAATGAGAAAACAGAGGGTGG + Intronic
966223445 3:177572907-177572929 CAGAAATAGTAGAAAGAGAAAGG - Intergenic
966759766 3:183407547-183407569 AAGAAGCAGAAGAAAGAGGGAGG - Intronic
967293554 3:187944607-187944629 CTGAATGAGAAGTGAGAGGGCGG + Intergenic
967607326 3:191462984-191463006 AAGAAAAAGAAAAAAGAGGGAGG - Intergenic
967761456 3:193230668-193230690 CACAATGAGAAAAAAGAAGGGGG + Intergenic
970219690 4:13797972-13797994 AAGAAGGAGAAGAAAGAAGGAGG + Intergenic
970473305 4:16397927-16397949 CAGAATTAGAAGAACAAGTTTGG + Intergenic
971218339 4:24682412-24682434 CAGAATGAAAAGAGAGAGGGAGG - Intergenic
971394402 4:26215022-26215044 AAGAAAGAAAAGAAAGAGGGAGG + Intronic
971869013 4:32211573-32211595 CAAAATTAGAAGAAACGGGGAGG + Intergenic
971919780 4:32922885-32922907 GAGAATTGGAAGAAAAAAGGAGG - Intergenic
973952637 4:56032523-56032545 CAGGCTTAGAAGAAAAAGAGTGG - Exonic
974015663 4:56646651-56646673 CAAAATGAAGAGAAAGAGGGAGG - Intergenic
974091393 4:57315049-57315071 GAGAAGTGGAAGAAAGAGGCTGG - Intergenic
975028214 4:69578510-69578532 GAGAAGAAGAAGAAAGAAGGAGG - Intergenic
975032040 4:69633076-69633098 AAGAATGAGAAGTAAGAGGTAGG + Intronic
976059761 4:81113365-81113387 TAGAATTTGAAAAAAAAGGGGGG - Intronic
976211213 4:82672307-82672329 CAGACTAAGAAAAAAGAGGTAGG + Intronic
976532965 4:86176968-86176990 CAGATGTAGAAGAAAGAGTCAGG + Intronic
977183845 4:93911611-93911633 GAGGAATAGAGGAAAGAGGGAGG - Intergenic
977448970 4:97170129-97170151 GAGAATTAGAGGAAAGAGTTTGG - Intergenic
978268539 4:106858990-106859012 AAGAAGAAGAAGAAAGAAGGAGG + Intergenic
978708400 4:111746074-111746096 TAAAAATAGAAGAAAGAGGAAGG - Intergenic
978976588 4:114882663-114882685 CAGAATAGGAAAAAAGAGAGTGG + Intronic
979193887 4:117897027-117897049 CATAATGAGAAGAAACAGGGTGG - Intergenic
979344559 4:119571458-119571480 CAGATTTTGAAGACAGAGGAAGG + Intronic
980266972 4:130529251-130529273 CAGAAATAGAACAAAGAACGTGG + Intergenic
980751119 4:137090377-137090399 AAGAATTGGAATAAAGAAGGTGG + Intergenic
980767850 4:137331503-137331525 CAGTATAAGAAGAAACAGGCAGG - Intergenic
981160191 4:141488254-141488276 CACAATTAGAACAAGGAGGCCGG - Intergenic
981216624 4:142177084-142177106 CTGAATTAGGAGAAAGAGGCAGG - Intronic
981572873 4:146172055-146172077 AAGAAGGAAAAGAAAGAGGGAGG - Intergenic
981763779 4:148223662-148223684 CTGAATTGGAAGAAAGAAAGAGG + Intronic
982013163 4:151126417-151126439 CAGTGCTAGAAGAAGGAGGGTGG - Intronic
982667782 4:158287952-158287974 TAGAATTTAAAGAAAGAGGCCGG + Intergenic
984227519 4:177052877-177052899 AAGAATAATAAAAAAGAGGGAGG + Intergenic
984306246 4:177995732-177995754 AAGACATAGAAGAAAGAGTGAGG - Intergenic
984538936 4:181013085-181013107 CAGAAGGAGAATAAAGAGGATGG + Intergenic
985031528 4:185795292-185795314 CAAAAATAGAAGAAAGAGGTCGG + Intronic
985895441 5:2748200-2748222 CAGAATTAGCAGAGTGAGGGCGG - Intronic
987435072 5:17884274-17884296 CAAAAGTAGAAGAAACAGTGTGG - Intergenic
987523882 5:19023075-19023097 GAGATTGAGAAGAAGGAGGGAGG - Intergenic
988101103 5:26680009-26680031 AAGAAAGAGGAGAAAGAGGGAGG - Intergenic
988243461 5:28645072-28645094 CAGAAGAAGAAGAAAGAGAAAGG + Intergenic
988856738 5:35234405-35234427 CAGGATTAGATGAAGGAAGGAGG - Intergenic
989138894 5:38182529-38182551 CAGACTTAGTAGAAAGAGCATGG + Intergenic
989373145 5:40731225-40731247 CAGCATTAGAAGGAAAAGGTTGG + Intronic
989654444 5:43731112-43731134 AAGAAGAAGAAGAGAGAGGGAGG - Intergenic
989681357 5:44032811-44032833 CAGTATTAGAACAAAGAGAGAGG + Intergenic
990516823 5:56538021-56538043 CAGCATTAAAAGAAATAGGCTGG + Intronic
990731803 5:58816770-58816792 CAGAATTGGAAGGAAGACGGAGG + Intronic
991092919 5:62710144-62710166 AAGAAAGAAAAGAAAGAGGGAGG - Intergenic
991272286 5:64798355-64798377 CAGGACAAGAAGAAAGATGGTGG - Intronic
991331706 5:65499602-65499624 CAGAAAGAGGAGAAAGTGGGTGG - Intergenic
991665059 5:68991363-68991385 GAGAAAAAGAAGAAAGAAGGTGG - Intergenic
991929022 5:71733391-71733413 CTGAATTAGCAGAAAGTGGGTGG + Intergenic
992673879 5:79085912-79085934 CAAAGTAAGAAGAAAGAGGATGG + Intronic
993077675 5:83254758-83254780 CACAATTGGAGGAAAGAGGCAGG + Intronic
993277934 5:85886210-85886232 TAAAATGAAAAGAAAGAGGGGGG - Intergenic
993746109 5:91598938-91598960 CAGTCTTAGAAGAATGAGGTGGG - Intergenic
994650438 5:102520255-102520277 CAGAATAGAAAGACAGAGGGAGG + Intergenic
994858138 5:105152322-105152344 CAGAAGGAGAAGAAAGAGAAAGG - Intergenic
994915998 5:105979839-105979861 CAGAATTAGAAAAAATAAGTAGG + Intergenic
994952834 5:106487197-106487219 CAAAATTATAAGAAAGAGAAAGG - Intergenic
994956668 5:106541731-106541753 AAGAAGTAGGAGGAAGAGGGAGG - Intergenic
995053067 5:107728688-107728710 CAGAGTCAGAAGAGAGAGTGAGG - Intergenic
995288680 5:110423155-110423177 CAGAATTAGAAGTGGGAGGATGG - Intronic
995466786 5:112458163-112458185 CAGAAAGAGAAGAAAGAGACAGG + Intergenic
996343751 5:122467583-122467605 AAGAAAAAGAAGAAAGAAGGAGG + Intergenic
996443606 5:123518746-123518768 CTGAGTTAGATGGAAGAGGGAGG + Intronic
996501395 5:124220560-124220582 AAGAAAAAGAAGAAAGAGGAGGG - Intergenic
996622796 5:125530086-125530108 GAGAAAGAAAAGAAAGAGGGAGG - Intergenic
997405358 5:133641916-133641938 AAGAAGAAGAAGAAAGAAGGAGG - Intergenic
997407799 5:133665783-133665805 CAGATTTAGAATACAGAGGAGGG - Intergenic
999512400 5:152266416-152266438 CAAAATTGGAAGAAACAGTGAGG + Intergenic
1000010113 5:157223135-157223157 CAGAGGCAGAAGGAAGAGGGAGG + Intronic
1000018017 5:157295472-157295494 TAGAATTAGAAGGAAGGGGGAGG - Intronic
1000753673 5:165129652-165129674 CTGAATTGAAAGGAAGAGGGAGG - Intergenic
1001123305 5:168997434-168997456 TAGAATTAACTGAAAGAGGGAGG + Intronic
1001472876 5:172027484-172027506 CAGAAGGAGAAGAGAGAGAGAGG - Intergenic
1001695900 5:173669598-173669620 CAGAAAAAGAGGAAAGAAGGAGG - Intergenic
1002701800 5:181129963-181129985 GAGAACGAGAAGAAAGAGTGAGG + Intergenic
1003396096 6:5753223-5753245 CAAACTTTGAAGAAAGATGGTGG + Intronic
1004368474 6:15031865-15031887 GAGAAGAAGAAGAAAGAGGAGGG + Intergenic
1005440117 6:25858290-25858312 AAGAATAAGAAGAAAGAGAATGG - Intronic
1006024208 6:31137158-31137180 AAGAAAAAGAAGAAAGAGGCCGG + Intronic
1007004556 6:38348210-38348232 CAGAAAAAGCAGAAAGAGAGAGG - Intronic
1008135289 6:47769253-47769275 CAGAATATGAAGAAAGTGAGAGG - Intergenic
1008367849 6:50703774-50703796 TAGAGGAAGAAGAAAGAGGGAGG - Intergenic
1008612833 6:53200032-53200054 GACTATTAGAAGAAAGGGGGAGG - Intergenic
1008675291 6:53812392-53812414 CAGAATTTGAAGAAAGAGGCCGG + Intronic
1009045709 6:58235625-58235647 CCCACTTAAAAGAAAGAGGGTGG - Intergenic
1009221523 6:60989949-60989971 CCCAATTAAAAGAAAGAAGGTGG - Intergenic
1009798218 6:68499574-68499596 CAGAAATAGAATAAAGAGGAAGG - Intergenic
1010389125 6:75317200-75317222 CACCAGTAGAGGAAAGAGGGAGG + Intronic
1011196549 6:84785838-84785860 CAGAATAGGAGGATAGAGGGTGG - Intergenic
1011325158 6:86142647-86142669 CAGAGGTTGGAGAAAGAGGGAGG + Intergenic
1012279585 6:97312927-97312949 CTGGATTTGAAGACAGAGGGAGG + Intergenic
1012976156 6:105783235-105783257 CAGAAGTAGAAGAAAGAAGGAGG + Intergenic
1013055041 6:106575118-106575140 CAGAGTTAAAATACAGAGGGGGG + Intronic
1014189798 6:118482123-118482145 CAGAATTACAAGGAAGAGAATGG + Intronic
1014711617 6:124812896-124812918 TAGAATTAGGAGAATGAGGAAGG - Intronic
1015732601 6:136363596-136363618 CTTAATTTGAAGATAGAGGGTGG - Intronic
1015732783 6:136365289-136365311 CTTAATTTGAAGATAGAGGGTGG - Intronic
1015989511 6:138922539-138922561 CAGAAAAAGAAGAAAAAGAGAGG + Intronic
1016856807 6:148678869-148678891 CAGAATTAGAAGCAAGCTGTGGG + Intergenic
1017999099 6:159562982-159563004 CAAAATAAAAAGAAAGAGGTTGG + Intergenic
1018053254 6:160030053-160030075 CAGACTGGGAAGAGAGAGGGAGG - Intronic
1018788266 6:167125680-167125702 CAGAACCAGAAGAAAGAGGGAGG - Intronic
1020361516 7:7331579-7331601 CAGAATTAGAAGGAGGTGAGAGG + Intergenic
1020402244 7:7792425-7792447 CAGAATTAGAAAAAGTAGGAGGG + Intronic
1020425203 7:8057717-8057739 CAGATTAAGAAGAAAAAGGAAGG - Intronic
1020893255 7:13906114-13906136 CTGAATTAGAGAAAAGAGGCAGG - Intronic
1020932180 7:14411757-14411779 CAGAAAAAAAAGAAAGAGGTAGG - Intronic
1021491706 7:21226247-21226269 CAGAATTTTAACAAAGAAGGAGG - Intergenic
1023655928 7:42420831-42420853 GAGAAAGAGGAGAAAGAGGGAGG + Intergenic
1023710443 7:42986896-42986918 CAGGATAGGAAGAAAGAGGAAGG + Intergenic
1023983913 7:45084471-45084493 CAGAACTTGAAGGAAGAAGGAGG - Exonic
1024032258 7:45471412-45471434 AAGAAGAAGAAGAAAGAAGGAGG + Intergenic
1024153778 7:46599736-46599758 CAGAAGCAGAAGAGAGAGAGAGG + Intergenic
1024511835 7:50210721-50210743 CAGAATTTGAAGGAGGTGGGAGG + Intergenic
1024773767 7:52758222-52758244 GAGAATTACAAGAAAAATGGGGG - Intergenic
1024797923 7:53039980-53040002 CAAAAATAGAAAAAAGAAGGAGG + Intergenic
1024846275 7:53646450-53646472 AAGAAAAAGAAGAAAGATGGTGG - Intergenic
1024955854 7:54918762-54918784 CAGAATCAAAAGACAGAGAGAGG + Intergenic
1025065500 7:55851710-55851732 CAGAAATAGAAAAAATAGGCCGG + Intronic
1025946375 7:66108005-66108027 CAGAATTAGAAGAAGTAAGTTGG + Intronic
1026056785 7:66991730-66991752 CAGAGTTTGCAAAAAGAGGGCGG + Intronic
1026104169 7:67407900-67407922 CAGAAGGAGAAGGAAGTGGGAGG - Intergenic
1026209677 7:68292866-68292888 CAAAATTAAAATAAAGGGGGAGG - Intergenic
1027746275 7:82078876-82078898 AAGAGGAAGAAGAAAGAGGGTGG + Intronic
1028021226 7:85776418-85776440 TAGAAGTAGAGCAAAGAGGGTGG - Intergenic
1028023844 7:85811342-85811364 GGCAATTAGACGAAAGAGGGAGG - Intergenic
1028072055 7:86462151-86462173 CAGAACTAGAAAATACAGGGTGG - Intergenic
1028873473 7:95794191-95794213 CAGAATCAGAAGAAAGGAGATGG - Intronic
1029871381 7:103696653-103696675 CAGAATTAGGAGTGAGAGGATGG - Intronic
1030065659 7:105656865-105656887 CTGCATTACAAGAAAGGGGGAGG - Intronic
1030447180 7:109661078-109661100 AAGAAGTAGAAAACAGAGGGAGG + Intergenic
1031160531 7:118162059-118162081 CAGTCTTAGAGGAAAGAGGGAGG + Intergenic
1032279728 7:130491195-130491217 CAGAGGCACAAGAAAGAGGGAGG - Intronic
1033253910 7:139782881-139782903 CAGAATTAAAATAAAGGGAGAGG - Intronic
1033282301 7:140014916-140014938 AAGAAGAAGAAGAAAGAAGGAGG + Intronic
1034386001 7:150741830-150741852 GAGAATTATTAGAAAGAGGCAGG - Intronic
1034952992 7:155313543-155313565 CAGAATGAGGAGAAAAGGGGAGG - Intergenic
1036708439 8:11061771-11061793 AAGAATGAGAAGAAGGAAGGGGG + Intronic
1036783211 8:11664782-11664804 GAGACTCAGAAGAAAGAGGGAGG - Intergenic
1037277719 8:17199663-17199685 AAGAAGAAGAAGAAGGAGGGAGG - Intronic
1037431261 8:18815605-18815627 AAGAATTTGAAGAAAGGGGCTGG - Intronic
1037946106 8:22990604-22990626 CAGAAGGAGGAGGAAGAGGGTGG + Intronic
1038324818 8:26564924-26564946 GAGACTCAGAAGAAGGAGGGTGG - Intronic
1040365476 8:46710764-46710786 CAGCTTTAGAAGATTGAGGGAGG - Intergenic
1040700948 8:50064760-50064782 CAGAATTATAAGAAGGAGCCAGG - Intronic
1040868368 8:52073996-52074018 CTCAAATAGAAGAAAGATGGTGG + Intergenic
1041406243 8:57502313-57502335 AAGGCTTAGAAGAAAGAGGAAGG - Intergenic
1042171838 8:65999198-65999220 TAGAATAAGGAGAAAGTGGGAGG - Intergenic
1042192012 8:66196683-66196705 CAGCTTTAGAAGAAGGAGAGTGG - Intergenic
1042788724 8:72579813-72579835 CAGAATAAGAAGATAGAGTAAGG - Intronic
1043296057 8:78665452-78665474 CAAGAGTAGAAGACAGAGGGAGG + Intergenic
1043486799 8:80705752-80705774 GAGAGCTAGAAGAAAGAGGCTGG - Intronic
1043830079 8:84978077-84978099 CAGAGTTAGAAGAATGTGGAAGG + Intergenic
1043986480 8:86698663-86698685 CAGATTTAGATGATAGAGTGAGG + Intronic
1044751092 8:95416033-95416055 CTGAAAGAGAAGAAAGAAGGGGG - Intergenic
1045606011 8:103777224-103777246 AAGAATTATAAGAAAAAAGGAGG + Intronic
1045664494 8:104470280-104470302 CAGCAATAAAAGAGAGAGGGGGG + Intergenic
1045784716 8:105907503-105907525 CAACATTAGAAGAAAGAGTACGG - Intergenic
1046279923 8:112013676-112013698 AAGAATAAGAAGAAAGATGTAGG + Intergenic
1046652373 8:116851235-116851257 AAGAATTACCAGAAGGAGGGTGG + Intronic
1046764071 8:118050869-118050891 AAGAATTAGAAGGTGGAGGGAGG + Intronic
1047106077 8:121731897-121731919 GAGACTCAGAAGGAAGAGGGTGG - Intergenic
1047259669 8:123244292-123244314 AAGAATTACAGGAAAGAAGGAGG - Intronic
1047574609 8:126138955-126138977 CAGAAGTAGGAGCAAGAGAGAGG - Intergenic
1048039211 8:130709176-130709198 GAGAATTAGAATGAGGAGGGTGG + Intergenic
1049648724 8:143752909-143752931 CAGAAAGAGAAGAAAGAGAAAGG - Intergenic
1049975786 9:860448-860470 CAGAGTAAGAAGAGTGAGGGAGG - Intronic
1050614345 9:7386427-7386449 CAGAATCAGAACAAAGAGGGAGG + Intergenic
1050676789 9:8064509-8064531 CAGAAATAGCAGAAAGATTGAGG - Intergenic
1051116820 9:13704877-13704899 CACAATTGGAAGAGAGAGGGAGG - Intergenic
1051193595 9:14539075-14539097 TGGAATTAGAGGAGAGAGGGAGG + Intergenic
1051216452 9:14803195-14803217 AAGAGAAAGAAGAAAGAGGGAGG - Intronic
1051338618 9:16090959-16090981 AAGAAAATGAAGAAAGAGGGTGG - Intergenic
1052133573 9:24882164-24882186 TAGATTTGGAAGAAAGAGAGAGG + Intergenic
1052443369 9:28527277-28527299 CAGAAACAGAAGAAAATGGGAGG - Intronic
1053836457 9:42141419-42141441 CAGAAACAGGAGAAAGAAGGAGG + Intergenic
1054355474 9:64057291-64057313 CAGATTTAGATGATAGAGTGAGG + Intergenic
1054702831 9:68431297-68431319 GAGAATGCGAAGAAAGAGGTAGG - Intronic
1054749009 9:68885673-68885695 AAGACTTAGAAGAGGGAGGGTGG + Intronic
1055502413 9:76914887-76914909 CAGAAACAGAAGAAATTGGGTGG - Intergenic
1055889481 9:81107580-81107602 AGGAATTTTAAGAAAGAGGGTGG + Intergenic
1056449529 9:86702633-86702655 GATGATTAGAAGAGAGAGGGAGG + Intergenic
1057287850 9:93774712-93774734 GAGAATTAGGAGAAAGAAAGAGG - Intergenic
1057318099 9:93984559-93984581 CAGGATTATAAGAAAGGGGGAGG + Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1058063738 9:100526361-100526383 CAAAAATAGAAAAAAGAGGAAGG - Intronic
1058078559 9:100676171-100676193 CAGAGTTGGAAGAAGGAGGTGGG + Intergenic
1058671778 9:107366452-107366474 CAGAGTAAGAAGAACCAGGGAGG - Intergenic
1059338781 9:113585621-113585643 CAGGATTAGAATAAACAGAGAGG + Intronic
1060423736 9:123487726-123487748 AAGAATTGAAAAAAAGAGGGGGG + Intronic
1060502475 9:124171663-124171685 CAGAAGTAGAAGAGAGAGAGAGG - Intergenic
1203743809 Un_GL000218v1:26389-26411 CAGATTTAGATGATAGAGTGGGG + Intergenic
1203566307 Un_KI270744v1:93146-93168 CAGATTTAGATGATAGAGTGAGG - Intergenic
1185661981 X:1735376-1735398 CAGGATAAGAAGAAAGGAGGAGG - Intergenic
1185814985 X:3146310-3146332 AAGAAGAAGAAGGAAGAGGGAGG - Intergenic
1186348440 X:8718528-8718550 TAGAATGAGAAGAAAATGGGAGG - Intronic
1186870631 X:13767688-13767710 GAGAAATAGAGGAAGGAGGGAGG - Intronic
1187459906 X:19477786-19477808 GAGAGGGAGAAGAAAGAGGGAGG + Intronic
1188451386 X:30310729-30310751 CAGCAAAAAAAGAAAGAGGGAGG - Intergenic
1188468705 X:30512443-30512465 CAGAAAGAGAAGAAAGAGTGGGG + Intergenic
1188609611 X:32079631-32079653 AAGAAAAAAAAGAAAGAGGGAGG + Intronic
1188874898 X:35417634-35417656 CAGAAATGGAAGAAAAAGCGAGG - Intergenic
1190227780 X:48559501-48559523 CAGACTTAGAAGGAAGACAGAGG + Intronic
1190915159 X:54806197-54806219 CAGAAGTAGAAGAAAAGGAGGGG + Intergenic
1191105773 X:56771218-56771240 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191106766 X:56776620-56776642 CAGAAGAACAAGAAAGAGGGAGG - Intergenic
1191820824 X:65305579-65305601 AAGGATTAAAAGAAAGAGTGAGG - Intergenic
1193074428 X:77340586-77340608 AAAAATGAGAAGAGAGAGGGTGG + Intergenic
1193597167 X:83461063-83461085 CAGGATTGGGAGAGAGAGGGAGG + Intergenic
1193846421 X:86477734-86477756 CAGAAATAAAGGAAAGAAGGAGG - Intronic
1193851804 X:86546312-86546334 AAGAAGAAGAAGAAAGAGGTAGG - Intronic
1194033039 X:88839276-88839298 CAGAAGAAGAAGAAAGAATGGGG + Intergenic
1195025536 X:100873202-100873224 CAGAAATGGAAGAATGAGAGTGG + Intronic
1195152384 X:102085112-102085134 CAAAATAAAAAGAAAGAGAGAGG + Intergenic
1195420530 X:104670371-104670393 CAGAACTAGAACAAAGCAGGTGG - Intronic
1196047968 X:111275943-111275965 TAGAATTAGAACAAAATGGGAGG + Intergenic
1196329488 X:114453753-114453775 AAGAACTAGAAGAAGGAGGGAGG + Intergenic
1196600301 X:117594050-117594072 GAGAAAAAGAACAAAGAGGGAGG + Intergenic
1196847876 X:119910956-119910978 TAAAATTAGAAGAAAAAGGCCGG - Intronic
1198119970 X:133582787-133582809 CAGAATCAGAAGGGAGAGAGTGG + Intronic
1198467512 X:136916910-136916932 AAGAATAAGAAGAAGGAGGAGGG - Intergenic
1198521874 X:137461229-137461251 CAGAAATAGAGAAAAGAGGCTGG + Intergenic
1198743682 X:139867685-139867707 CAGGCTAAGAAGTAAGAGGGAGG + Intronic
1200255071 X:154576690-154576712 AAGAATTAGAAGCAAGAGTTTGG + Intergenic
1200262698 X:154627714-154627736 AAGAATTAGAAGCAAGAGTTTGG - Intergenic
1201157131 Y:11141370-11141392 CAGATTTAGATGATAGAGTGTGG + Intergenic
1202174918 Y:22089095-22089117 CAGAACTAAAAGAAATAGAGAGG + Intronic
1202216444 Y:22497287-22497309 CAGAACTAAAAGAAATAGAGAGG - Intronic
1202326743 Y:23698782-23698804 CAGAACTAAAAGAAATAGAGAGG + Intergenic
1202544026 Y:25971271-25971293 CAGAACTAAAAGAAATAGAGAGG - Intergenic