ID: 919365249

View in Genome Browser
Species Human (GRCh38)
Location 1:196651356-196651378
Sequence GACCTTGGTGGTGGTTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 8, 3: 74, 4: 405}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919365249 Original CRISPR GACCTTGGTGGTGGTTTCAC AGG Intergenic
900189705 1:1348215-1348237 GGCCTCGGTGGTGGTGTCCCAGG - Intronic
900389371 1:2427381-2427403 GCCCCTGCTGGTGGTTTCTCCGG + Intronic
902717061 1:18280140-18280162 GACCTTGTAGGGGGTGTCACAGG + Intronic
902891952 1:19450894-19450916 AACATTGGTGGTGGTGTCACTGG - Intronic
903386073 1:22927680-22927702 GACCTAGTTGGTGGTTGCACAGG + Intergenic
903524138 1:23980111-23980133 GACCCTGGTGGTGGCGGCACTGG - Intronic
904298056 1:29536134-29536156 GATTGTGGTGATGGTTTCACAGG + Intergenic
904801305 1:33094660-33094682 GACCTTGGTGGTGGCTTCCCTGG + Exonic
904889738 1:33770900-33770922 GCCCTTGGTGAAGGTTTTACAGG + Intronic
905548951 1:38820706-38820728 GACCTGGGTGGTGGTTACAAAGG + Intergenic
905970542 1:42138616-42138638 GATTGTGGTGATGGTTTCACAGG - Intergenic
906249288 1:44299083-44299105 GACCTGGGTGGTAGTTACCCAGG + Intronic
907070704 1:51532088-51532110 GACCTTGGTAATCGTTTCAGGGG + Intergenic
907466299 1:54639978-54640000 GATCTGGGTGCTGGTTTCATGGG + Intergenic
908090745 1:60683218-60683240 TACCTTGGCAGTGTTTTCACTGG + Intergenic
909384194 1:75036687-75036709 GACCTTGGTGGTGTAGGCACAGG - Intergenic
909442221 1:75710155-75710177 GATTGTGGTGATGGTTTCACAGG + Intergenic
909567517 1:77070586-77070608 GACCTTCGTAGTGGTTACTCAGG - Intergenic
910247350 1:85153875-85153897 GGTCTAGGTGGTGGTTTCATAGG - Intergenic
910324761 1:85993634-85993656 GATCTTGGTGATGGTTTCACAGG + Intronic
911563928 1:99440105-99440127 GATCTGGGTGGTGGTTACATAGG + Intergenic
911826714 1:102495872-102495894 GACAATGGTGATGGTTTCACAGG + Intergenic
912660189 1:111520923-111520945 GACTGTGGTGATGGTTTCACAGG - Intronic
913266009 1:117045262-117045284 GACCTAGGTTGTGGTTTCATGGG + Intergenic
913356089 1:117923665-117923687 GACTTTGGTGGTGGTTCTAGGGG - Intronic
913549155 1:119899724-119899746 GATAATGGTGATGGTTTCACAGG + Intergenic
916172865 1:162014142-162014164 GAGCTGGTTGGTGGTTACACAGG + Intronic
916492777 1:165316393-165316415 GACCGTGGTGCTGGTTCCATAGG - Intronic
916559349 1:165919895-165919917 GATTTTGGTGATGGTTTCAGAGG - Intergenic
918146627 1:181762146-181762168 GACCATGGCAATGGTTTCACAGG + Intronic
918279813 1:182993405-182993427 CACCTGGATGGTGGTTACACAGG + Intergenic
918613877 1:186522681-186522703 GCTCATGGTGGTGGTTTCTCAGG + Intergenic
919324129 1:196084029-196084051 GAACATGGTGATGGTTTCCCAGG + Intergenic
919365249 1:196651356-196651378 GACCTTGGTGGTGGTTTCACAGG + Intergenic
920053514 1:203177295-203177317 GACCTGGGTGGTGGTTACACAGG + Intergenic
920385256 1:205567065-205567087 GATCTAGGTGGTAGTTACACAGG - Intergenic
920562331 1:206947687-206947709 TACCTAGGTGGTGGGTTGACGGG - Intergenic
920967424 1:210712654-210712676 GAACTTGCTGCTGGTGTCACAGG + Intronic
921465689 1:215484256-215484278 GGACTTGGGGGTGGTTTCACTGG + Intergenic
921848039 1:219904896-219904918 GACCTTGGTGTTGGTGGGACTGG + Intronic
922231265 1:223688841-223688863 GACCTTGTTGCTGGTTTTCCAGG - Intergenic
922316256 1:224445045-224445067 GACCTGGGTGATGGTTTCACGGG - Intronic
922439289 1:225639247-225639269 GACCTGGTTGGTGGCTACACAGG + Intronic
922615736 1:226960313-226960335 GTACTTGGTGGTGGTATCAGTGG + Intronic
922615788 1:226960538-226960560 GTACTTGGTGGTGGTGTCAATGG + Intronic
922978239 1:229802831-229802853 CACCGTTGTGGTGGTTTCAAGGG - Intergenic
924295385 1:242581840-242581862 GATCTTGGCTGTGGTTACACAGG - Intergenic
924526884 1:244860681-244860703 AACCTTGGTATTAGTTTCACAGG - Intronic
924920433 1:248623383-248623405 GGCTTTGGTGGTGGCTTCTCTGG - Intergenic
1063164510 10:3448029-3448051 GATGATGGTGCTGGTTTCACTGG - Intergenic
1063413026 10:5851355-5851377 GATTTTGGTGATGGTTTCACGGG - Intergenic
1063635371 10:7777399-7777421 TATCTGGGTGGTGGTTCCACAGG + Intronic
1064289636 10:14021703-14021725 AATCTGGGTGGTGGTTACACAGG + Intronic
1064713881 10:18155131-18155153 TACCTGGGTGGTGGCTCCACAGG - Intronic
1064778829 10:18810657-18810679 GATTGTGGTGATGGTTTCACAGG - Intergenic
1065270289 10:24024026-24024048 GGTCTGGGTGGTGGTTACACAGG + Intronic
1065338079 10:24675487-24675509 GACTGTGGTGATGTTTTCACTGG + Intronic
1067569414 10:47360557-47360579 GACCTTGGAGGTGGGTTTCCTGG - Intergenic
1067749377 10:48960030-48960052 CAGCTTGGTGAGGGTTTCACTGG + Intronic
1067843903 10:49703158-49703180 TCCCTTGGCTGTGGTTTCACCGG + Intronic
1068546299 10:58349735-58349757 GAGCTGGGTGCTGGTTTCACAGG - Intronic
1068587895 10:58820574-58820596 CACCTTGGTTGTGGTTTCAGAGG + Intronic
1069435927 10:68382804-68382826 GACCTGGGTGGAGGTTACGCAGG + Intronic
1069472043 10:68702216-68702238 GACCTGGATGGAGGTTACACAGG - Intergenic
1070717049 10:78730055-78730077 GACCTGGGTGGTGTTTACATAGG - Intergenic
1071814773 10:89221126-89221148 GATTATGGTGATGGTTTCACAGG + Intronic
1072270877 10:93775155-93775177 GACCTGGGTGCTGGTTACAAGGG - Intronic
1073831701 10:107391752-107391774 GATTTTGGTGATGGTATCACAGG - Intergenic
1073862140 10:107758564-107758586 GATTGTGGTGATGGTTTCACAGG - Intergenic
1073874875 10:107911011-107911033 AACCTTGGTGGTAATTACACTGG - Intergenic
1074034434 10:109724151-109724173 GACATCGGGGGTGGTGTCACTGG + Intergenic
1074156034 10:110800574-110800596 GACTTTGGTGGTGGTTTTACGGG - Intronic
1074384544 10:113006537-113006559 GATCTGGGTCGTGGTTACACAGG - Intronic
1074744692 10:116520619-116520641 GATCATGGTAATGGTTTCACGGG - Intergenic
1074797897 10:116967515-116967537 GATGGTGGTGATGGTTTCACAGG - Intronic
1074917334 10:117970162-117970184 GAGCTGGGTGGTGAGTTCACAGG + Intergenic
1075263353 10:120981013-120981035 CATCTGGGTGCTGGTTTCACAGG - Intergenic
1075820698 10:125306440-125306462 GACCTGGGAGGTGGTTACAAGGG - Intergenic
1076805059 10:132851461-132851483 GAAGGTGGTGATGGTTTCACGGG - Intronic
1077406610 11:2385282-2385304 GGAGTTGGTGATGGTTTCACGGG - Intronic
1077408349 11:2392495-2392517 GTCCTTGGCTGTGGTTTCCCTGG + Intronic
1077617328 11:3686665-3686687 GATCGTGATGGTGGTTTTACAGG - Intronic
1078371911 11:10754492-10754514 GATTGTGGTGATGGTTTCACAGG - Intronic
1079120870 11:17684023-17684045 GCCCTTGGTGATGGCTTCCCTGG - Intergenic
1079173135 11:18115146-18115168 TACCTTGATGGTGGTTCTACTGG - Intronic
1079204770 11:18404901-18404923 GAGCTGGGTGGTGGGTTCACAGG - Intronic
1079350455 11:19687452-19687474 GACCTGGATGGTGGTTACACAGG - Intronic
1080022628 11:27579031-27579053 TACTTAGGTGGTGGGTTCACAGG + Intergenic
1080148010 11:29012006-29012028 GACTGTAGTGGTAGTTTCACAGG - Intergenic
1080877233 11:36287875-36287897 GACTTTGGTGGTGGTTACATTGG + Intronic
1082670573 11:56032051-56032073 GATACTGATGGTGGTTTCACTGG + Intergenic
1083016258 11:59457386-59457408 GGCCTTGGTGGTGGCTTCTTGGG + Exonic
1084287036 11:68138699-68138721 GAGCTAGGTGGTGGGTACACAGG + Intergenic
1084496557 11:69508084-69508106 GATCTTGGTGGTGGTTTCATGGG - Intergenic
1084935332 11:72583831-72583853 GACCTTGGGGCTGGATTCCCAGG + Intronic
1085500170 11:77014044-77014066 GATTGTGGTGGTGGTTTCATGGG + Intronic
1085508973 11:77075774-77075796 GACCTGGGTGGTGGTTCCATGGG - Intronic
1086253261 11:84843183-84843205 GATTATGGTGATGGTTTCACAGG + Intronic
1091555744 12:1572315-1572337 GACTGTGGTGCTGGTTTCATGGG - Intronic
1094439177 12:30456225-30456247 GACAGTGGTGATGGTTTCATAGG - Intergenic
1094454034 12:30612341-30612363 GATTGTGGTGGTGGTTTCATGGG + Intergenic
1095160416 12:38907414-38907436 GATTTTGGTGATGGCTTCACAGG - Intronic
1095215433 12:39542058-39542080 AACCTGGGTGGTGGTTAAACAGG + Intergenic
1097281160 12:57846187-57846209 GACCTCCGTGGGGGTTGCACGGG - Intronic
1097512820 12:60565134-60565156 TACATTGGTGGTGGCTTCTCTGG + Intergenic
1097747887 12:63319123-63319145 TAGCTTGAAGGTGGTTTCACCGG + Intergenic
1097819728 12:64116338-64116360 AAGCTTGGTGGTGGTTTCATTGG - Intronic
1099653742 12:85462358-85462380 GACTGTGGTGATGGTTTCATGGG + Intergenic
1100517911 12:95345796-95345818 GATCTGGGTGGTGATTACACAGG + Intergenic
1100726371 12:97413270-97413292 GAACTGGGTGGTGGTTACATTGG + Intergenic
1100894679 12:99168114-99168136 GATTGTGGTGATGGTTTCACAGG + Intronic
1100995789 12:100299428-100299450 GATCGTGGTGATGGTTTCACAGG - Intronic
1101626743 12:106451202-106451224 GACTATAGTGGTGGTTTCACAGG + Intronic
1101701764 12:107180425-107180447 GACCTAGGTGGTGGCTACATGGG - Intergenic
1101834339 12:108284818-108284840 GACCTAGATAGTGGTTACACGGG - Intergenic
1101917803 12:108909636-108909658 GACCTTGGTGGTGTTCACAATGG - Intergenic
1101980176 12:109399262-109399284 GATCTGGGTGGTGGTTACAGAGG - Intronic
1102906610 12:116680995-116681017 GATTGTGGTGGTGGTTTCACAGG + Intergenic
1103438602 12:120946520-120946542 GATCATGGTGATGGTTTCACAGG - Intergenic
1103836567 12:123825724-123825746 GATTGTGGTGGTGCTTTCACAGG + Intronic
1104357600 12:128101546-128101568 TGCCTTGGTGGTGGCTACACTGG - Intergenic
1105790486 13:23793441-23793463 GATCTGGGTGGTGGTTCCACAGG + Intronic
1106214885 13:27687842-27687864 GATTATGGTGATGGTTTCACAGG + Intergenic
1107523084 13:41202492-41202514 GACCTGAGTGGAGGTTACACAGG - Intergenic
1107583827 13:41822079-41822101 GATATTGGTGATGGTTTCATGGG + Intronic
1108132538 13:47318273-47318295 GAATGTGGTGATGGTTTCACAGG - Intergenic
1108634923 13:52323681-52323703 GAACTAGGTGGTGGTTTCTGGGG - Intergenic
1108652881 13:52499508-52499530 GAACTAGGTGGTGGTTTCTGGGG + Intergenic
1108780803 13:53829726-53829748 GACTATAGGGGTGGTTTCACAGG + Intergenic
1109218614 13:59617553-59617575 GGCCTTGGGGGTGTTTTCAATGG - Intergenic
1109886075 13:68547076-68547098 GATGATGGTAGTGGTTTCACAGG - Intergenic
1110289111 13:73783935-73783957 GACATTGGAGGTGTTTTGACAGG - Intronic
1110745146 13:79043642-79043664 GATTGTGGTGATGGTTTCACTGG + Intergenic
1111633488 13:90873775-90873797 GGACTTGGTGGTGGTTCCACAGG - Intergenic
1112677977 13:101726470-101726492 GATCTAGGTGATGGTTGCACAGG - Intronic
1113182385 13:107644809-107644831 GATCTGGGTGGTGGTTCCAGAGG - Intronic
1114651290 14:24286232-24286254 GACTGTGGTGGTGGTATCCCTGG - Intergenic
1116310683 14:43322481-43322503 GATTGTGGTGGTGGTTTCATAGG + Intergenic
1117301381 14:54431810-54431832 GATCTGGGTGGTAGTTTAACAGG + Intronic
1117868006 14:60169558-60169580 GATTGTGGTGATGGTTTCACAGG - Intronic
1118478222 14:66138928-66138950 GATCTTGGTGGTGGTCACACAGG - Intergenic
1118929223 14:70224611-70224633 GACCTGGGTGGTGGTTACGCAGG + Intergenic
1119483763 14:74975337-74975359 GTCTTTGGTGGAGGTTTCCCAGG + Intergenic
1120278625 14:82410564-82410586 GATGGTGGTGATGGTTTCACAGG - Intergenic
1120901905 14:89582708-89582730 GATCATGGTGATGGTTTCACAGG - Intronic
1121096603 14:91221831-91221853 AATCTTGGTGGTGGTTGCAAGGG - Intronic
1121167703 14:91823030-91823052 GACTGTGGTGATGGTTTCATAGG + Intronic
1122594900 14:102883534-102883556 GACCTGGGTGTTGGCTTCATGGG + Intronic
1123179353 14:106453911-106453933 GCCCATGGTGCTGCTTTCACAGG + Intergenic
1202837027 14_GL000009v2_random:85938-85960 GAGGTTGGTGGTGGGTCCACCGG + Intergenic
1126028355 15:44471491-44471513 GATGATGGTGATGGTTTCACAGG - Intronic
1126145197 15:45467277-45467299 GATTGTGGTGATGGTTTCACAGG - Intergenic
1127183177 15:56447730-56447752 GATTGTGGTGATGGTTTCACAGG - Intronic
1128873267 15:71180487-71180509 GATTGTGGTGGTGGTTTCAGGGG + Intronic
1128964414 15:72043760-72043782 GACTGTGGTGGTGGTTTCATGGG + Intronic
1129498246 15:76008051-76008073 GATGGTGGTGGTGATTTCACAGG + Intronic
1130014792 15:80178270-80178292 GATCTGGGTGCTGGTTGCACAGG - Intronic
1130885307 15:88087697-88087719 GACAGTGGTGGCGATTTCACTGG + Intronic
1131018435 15:89077084-89077106 GAGCTGGGTGGTGGTTACACAGG - Intergenic
1131593047 15:93769556-93769578 GTCCTTGGAGGTGGGTTCTCTGG + Intergenic
1132257951 15:100394080-100394102 GACCTGGGTGGTGGTTACATGGG - Intergenic
1132301840 15:100780910-100780932 GACCATGGTGATGGTTTCCTGGG + Intergenic
1132653603 16:1032366-1032388 GACCTGGGGGGTGGTTCTACAGG - Intergenic
1133548661 16:6832870-6832892 GACCTTGGTTCTGGATTGACAGG + Intronic
1133574942 16:7079738-7079760 GATCTAGGTGGTGGTTACACAGG + Intronic
1134035740 16:11029811-11029833 GATCATGGTGATGATTTCACGGG - Intronic
1136422381 16:30143268-30143290 GACCTTGCTGGTGGCTTCCCAGG + Intergenic
1137056446 16:35748601-35748623 GACCTTGGTGGTGCTTGGATGGG + Intergenic
1137552268 16:49445829-49445851 GATTTTGGTGATGGTTTCATGGG - Intergenic
1137601427 16:49758974-49758996 GACCTGGGAAGTGGTTTCAATGG + Intronic
1137735373 16:50719638-50719660 GTCCTGGGAGGTGGTTTCCCCGG - Intronic
1138165756 16:54800179-54800201 GACCTGGCTTGTGGTTTCAAGGG + Intergenic
1138890367 16:61135926-61135948 GAATTTGGTGATGGTTTCATGGG + Intergenic
1139594608 16:67950450-67950472 GAACTTGGTGGTGGGCACACTGG - Exonic
1139668612 16:68475764-68475786 GATTGTGGTGGTGGTTTCACAGG - Intergenic
1140318577 16:73924280-73924302 GATTGTGGTGGTAGTTTCACTGG - Intergenic
1141059073 16:80847938-80847960 TACCTTGGTGATGGGTTGACAGG + Intergenic
1141520171 16:84573443-84573465 GATCTGGGTGGTGGCTTCAAAGG + Intronic
1141906727 16:87031576-87031598 GATCATGGGGGTGGTTTCTCTGG + Intergenic
1141944187 16:87298321-87298343 GACCTCGGTGGTGGTGGCAGTGG - Intronic
1142627941 17:1203955-1203977 GACCTCGGTGCCGGCTTCACGGG + Intronic
1143370843 17:6438127-6438149 GACCTAGGTGATGGTTACATGGG + Intergenic
1143752532 17:9039583-9039605 GATTGTGGTGATGGTTTCACAGG - Intronic
1144002572 17:11069384-11069406 GACTGTGGTGATGGTATCACAGG - Intergenic
1146673488 17:34757709-34757731 GACCTGGGAGGTGGTTTCCTGGG - Intergenic
1147560585 17:41506560-41506582 GTCCTGGGTGGTGTTTACACAGG - Intergenic
1147577730 17:41612366-41612388 GGCTTTGGTGGTGGTTTTGCTGG - Exonic
1149211097 17:54302156-54302178 GACCTGAGTAGTGGTTTCATGGG + Intergenic
1150727042 17:67659838-67659860 GATTGTGGTGATGGTTTCACAGG - Intronic
1151056759 17:71040966-71040988 GATTTTGGTAGTGGTTTCACAGG + Intergenic
1151514411 17:74583082-74583104 GATCATGGTGGTGGTGTTACCGG - Intronic
1151581796 17:74983474-74983496 GAGCTGGGTGCTGGTTACACAGG - Intergenic
1152054332 17:78011255-78011277 GATCATGGTGATGGTTTAACAGG - Intronic
1152324001 17:79625070-79625092 GATGGTGGTGATGGTTTCACGGG - Intergenic
1152338787 17:79713201-79713223 GAGCTTGGTGGGGGCTGCACAGG - Intergenic
1152788981 17:82268080-82268102 GACCTTGGTGTCGGTTCCACAGG - Intronic
1153098199 18:1433877-1433899 GATTGTGGTGGTGCTTTCACAGG + Intergenic
1153607759 18:6851970-6851992 GACTGTGGTGATGGTTTCATAGG + Intronic
1154299311 18:13179197-13179219 GATTGTGGTGATGGTTTCACTGG - Intergenic
1154299485 18:13180641-13180663 GATTATGGTGATGGTTTCACAGG - Intergenic
1156206521 18:34892047-34892069 GATTGTGGTGATGGTTTCACAGG + Intergenic
1156210929 18:34941678-34941700 GAGCATGGTGATGGTTACACTGG + Intergenic
1156591404 18:38493278-38493300 GATGTTGGTGATGGTTTTACAGG + Intergenic
1157885936 18:51366383-51366405 GATCTCAGTGGTGGTTACACAGG - Intergenic
1158605965 18:58896473-58896495 GACATGGGTGGTGGCTTGACTGG - Intronic
1158858236 18:61565649-61565671 GACTGTGGCGGTGGTTTCATGGG - Intergenic
1158982351 18:62775766-62775788 GACTGTGGTGGTGGTTTCACAGG - Intronic
1161579662 19:5073789-5073811 GTTCTTGGTGGTGCTTTCACAGG + Intronic
1161926924 19:7307760-7307782 GATGGTGGTGGTGTTTTCACAGG + Intergenic
1163415005 19:17181038-17181060 GGCCTTGGTGGGGGACTCACAGG - Exonic
1164452379 19:28377973-28377995 GATGGTGGTGATGGTTTCACAGG - Intergenic
1164487370 19:28670304-28670326 GATCTGGGTGGTGGTTACATGGG + Intergenic
1164980451 19:32609734-32609756 GATGGTGGTGATGGTTTCACAGG + Intronic
1165338819 19:35195403-35195425 GACCTTTGTGGTTGTCCCACAGG + Intergenic
1165440730 19:35825471-35825493 GATTGTGGTGGTGGTTGCACGGG - Intergenic
1165797116 19:38525868-38525890 GGCCTTGGTGGAGGGTTCAGAGG - Intronic
1166250219 19:41564697-41564719 TCCCTTGGCGGTGGTGTCACTGG + Intronic
1166251611 19:41575566-41575588 GTCCTTGGTGAAGGTTTCAGGGG - Intronic
1166811759 19:45518636-45518658 GATCTGGGAGGTGGTTTCCCGGG - Intronic
1166865587 19:45834678-45834700 GATCTGGGTGATGGTTACACTGG + Intronic
1167122540 19:47527244-47527266 GACTGTGGTGATGGTTTCCCAGG + Intronic
1167731640 19:51261935-51261957 GACCTCAGTGGTGGTTACACTGG - Intronic
1168616972 19:57846050-57846072 GACTCTGATGATGGTTTCACGGG - Exonic
1168637383 19:58007101-58007123 GATCTGGGTGGTGGTTACACAGG + Exonic
1202635608 1_KI270706v1_random:41412-41434 GAGGTTGGTGGTGGGTCCACCGG - Intergenic
925971496 2:9109737-9109759 AGGCTGGGTGGTGGTTTCACAGG + Intergenic
926187855 2:10705637-10705659 GACCTGGGTGGTGGCTTCATGGG + Intergenic
926211861 2:10877173-10877195 GACTTGGGTGGTGGTTACACAGG + Intergenic
926502471 2:13673315-13673337 GACCTTGGCCGTGGCTTCAGAGG - Intergenic
927831706 2:26357093-26357115 GAGCTGGGTGGTGGTTACATGGG - Intronic
928319209 2:30269789-30269811 GACCTGGGTAGTGGTTTTATGGG - Intronic
928711126 2:34006831-34006853 GATTGTGGTGATGGTTTCACAGG - Intergenic
930524956 2:52516814-52516836 TATAGTGGTGGTGGTTTCACAGG + Intergenic
931455235 2:62404869-62404891 AAACTTGGTGGTGGATGCACGGG + Intergenic
931555952 2:63505342-63505364 GACCTTGGTGGTTTATTCACAGG - Intronic
931573463 2:63695713-63695735 GACCTGGGTGCTGGTTACATGGG - Intronic
931703763 2:64929677-64929699 GATTGTGGTGATGGTTTCACTGG - Intergenic
933169956 2:79114213-79114235 GACCCTGGTGTTAGGTTCACTGG + Intergenic
933568879 2:83983810-83983832 GACCTGAGTGGTGATTACACAGG - Intergenic
934876147 2:97922811-97922833 AATCTGGGTGGTGGTTACACAGG + Intronic
934990417 2:98916402-98916424 GATCATGGTGTTGGTTTCACAGG + Intronic
935183472 2:100710719-100710741 GACTGTGGTGATGGTTTCACAGG + Intergenic
935668183 2:105532252-105532274 GATCTGGGTGGTGGTTACAGAGG + Intergenic
936339864 2:111621600-111621622 GATCTTGGTGGTGGTTTCATGGG + Intergenic
937192520 2:120117710-120117732 GATTATGGTGTTGGTTTCACGGG - Intronic
937313013 2:120913853-120913875 GGCCCTGGTGATGGTTTCCCAGG - Intronic
937488657 2:122342259-122342281 GGCCTCCTTGGTGGTTTCACCGG + Intergenic
938540317 2:132279757-132279779 TCCCTTGGCTGTGGTTTCACTGG + Intergenic
941569095 2:167147338-167147360 GAGCTTGGAGGTTGTTTCCCAGG - Intronic
941684428 2:168433917-168433939 GGCTTTGGTGGTGGTGTCTCTGG - Intergenic
941989383 2:171540091-171540113 AATCTAGGTGCTGGTTTCACAGG - Intronic
942348126 2:175024837-175024859 GATTGTGGTGATGGTTTCACAGG - Intergenic
942429123 2:175890839-175890861 GACCTTGGGGCTGGAGTCACTGG + Intergenic
942589120 2:177522166-177522188 GACTGGGGTGATGGTTTCACAGG - Intronic
944524188 2:200601528-200601550 GACCGTGGTGATGGTTTCATGGG + Intronic
945884035 2:215355739-215355761 GACCTGGTTGGTGGTGACACAGG - Intergenic
946169294 2:217885034-217885056 GACCTTGATGATGCTTTCAAAGG - Exonic
946383975 2:219370456-219370478 GATTGTGGTGGTGGTTTCCCAGG + Intergenic
946990982 2:225329170-225329192 GACCATGGGGGCGGTTTCTCAGG - Intergenic
947295239 2:228623701-228623723 GACTGTGGTGATAGTTTCACAGG + Intergenic
947377230 2:229509052-229509074 GTTTTTGGTGGTGGTTTCACTGG + Intronic
947387234 2:229603675-229603697 GATCTGAGTGGTGGTTACACAGG + Intronic
948663853 2:239522623-239522645 GACCTTGATGGGGGCTGCACTGG - Intergenic
1170151584 20:13232235-13232257 GACTATGGTGATGGTTTTACAGG - Intronic
1170231925 20:14058117-14058139 GACTTGGGTGGTGGTTACATGGG + Intronic
1170480456 20:16760315-16760337 CACCTGGGTGGGTGTTTCACGGG - Intronic
1170570736 20:17630984-17631006 CTCCTTGGTGATGGCTTCACTGG - Intronic
1171869243 20:30512760-30512782 TCCCTTGGCTGTGGTTTCACTGG + Intergenic
1172178192 20:32985185-32985207 CACCTTGGTTCTGGTTCCACAGG - Exonic
1172202332 20:33135355-33135377 GATCTGGGTGGTGGTTGCAAGGG - Intergenic
1172422556 20:34829638-34829660 GATCTAGGTGGTGGTAACACAGG - Intergenic
1172621867 20:36322851-36322873 GACCTTAGTGGTAGTTACAAGGG - Intronic
1174527182 20:51182273-51182295 GACCTTAATGATGATTTCACAGG - Intergenic
1174530095 20:51204881-51204903 GATCATGGTGGTGGTTACATGGG - Intergenic
1174897439 20:54465765-54465787 GATTATGGTGGTGATTTCACAGG + Intergenic
1175214397 20:57383815-57383837 GACTGTGGTGATGGTTTCATGGG - Intergenic
1175420877 20:58832411-58832433 GACCTTGGTGATATTTTGACTGG - Intergenic
1178749256 21:35284807-35284829 GATCTGGGTGGTGGTTACACGGG - Intronic
1178846575 21:36178881-36178903 GATTGTGGTGATGGTTTCACAGG - Intronic
1179435005 21:41355749-41355771 GACCATGGTGATGGTTGCACAGG + Intronic
1179911779 21:44454749-44454771 GATTGTGGTGATGGTTTCACAGG + Intergenic
1180365103 22:11931814-11931836 GAGGTTGGTGGTGGGTCCACTGG + Intergenic
1181750043 22:24982887-24982909 GGCCTGGGTGCTGGTTTCCCTGG + Intronic
1181757397 22:25033976-25033998 GACTGTGATGGTGGTTTCACAGG - Intronic
1181791090 22:25267088-25267110 GGTCCTTGTGGTGGTTTCACTGG + Intergenic
1181798859 22:25330940-25330962 TACCTAGGTGATGGTTTGACAGG - Intergenic
1181826901 22:25524118-25524140 GGTCCTTGTGGTGGTTTCACTGG + Intergenic
1182765102 22:32752979-32753001 GACCCTTCTGGTGGTTTCAGTGG - Intronic
1183974853 22:41505822-41505844 GATTGTGGTGCTGGTTTCACAGG + Intronic
949346514 3:3081928-3081950 GACCTTGGTTGTGTTTTCAGGGG - Intronic
950651116 3:14407403-14407425 GATTTGGGTGGTGGTTACACAGG - Intronic
950823308 3:15786537-15786559 GACTGTGGTGATGGTTTCATAGG + Intronic
951440697 3:22719940-22719962 GATCGTGGTGATGGTTCCACAGG - Intergenic
951797739 3:26559889-26559911 GATTGTGGTGGTGATTTCACAGG + Intergenic
951843487 3:27060519-27060541 GACCTGGGCAGTGGTTTCATGGG + Intergenic
952295699 3:32060026-32060048 GATCTGGTTGGTGGTTACACAGG + Intronic
952442795 3:33349927-33349949 GACCCGGATGGTGGTTTTACTGG + Intronic
952769528 3:36985361-36985383 GACCTGGGTGGTGCATTCAAGGG + Intergenic
952798491 3:37265630-37265652 GATGGTGGTGATGGTTTCACAGG - Intronic
952961334 3:38591567-38591589 GAGTTTGGTGGTGGGTGCACAGG - Intronic
953481038 3:43252470-43252492 GACCTGGGTGGTGATTATACAGG - Intergenic
953758677 3:45669504-45669526 GATCTGGGTGGTGGTTACAGGGG - Intronic
953769039 3:45764840-45764862 GACCTAGGTGGTGGTTCCTTGGG + Intronic
953843976 3:46412338-46412360 GACTGTGGTGATGGTTTCATTGG + Intronic
955402105 3:58599621-58599643 GATCTGAGTGGTGGTTACACAGG + Intronic
955459423 3:59164401-59164423 GATTTTGGTGATGGTTTAACTGG - Intergenic
956729158 3:72180805-72180827 GAGCTGGGTGGTGGTTGCATAGG + Intergenic
958474971 3:94569109-94569131 GTCCTTGGGGCTGCTTTCACAGG - Intergenic
959402492 3:105920654-105920676 TACCTAGGTGGTGGGTTGACAGG - Intergenic
959613426 3:108320356-108320378 AACCTTGGTGGAGGATTCAAGGG - Intronic
961527181 3:127512483-127512505 GACCTGGTTGGTGGCTTCATGGG + Intergenic
961639418 3:128355494-128355516 TATCATGGTGATGGTTTCACAGG + Intronic
961855984 3:129871586-129871608 GAGCTTAGTTGTGGTTACACGGG - Intronic
961860356 3:129912369-129912391 GATCTGGGTGGTGGTTACACAGG + Intergenic
962202071 3:133409186-133409208 CACATTGGTGGTGGTAGCACTGG + Intronic
962542710 3:136399298-136399320 GATGTGGGTGGTGGTTACACAGG - Intronic
962557483 3:136570132-136570154 CATCTTGGTTGTGGTTACACAGG - Intronic
964651763 3:159019414-159019436 GATCTGGATGGTGGTTACACAGG - Intronic
966026550 3:175290516-175290538 GACTTTGGTGGTGGTTACATGGG + Intronic
966809935 3:183834638-183834660 GAGTGTGGTGATGGTTTCACGGG + Intronic
968092255 3:195906664-195906686 GAAGGTGGGGGTGGTTTCACGGG + Intronic
968198209 3:196728236-196728258 GACCTAGGTGGTAGTTACAAGGG + Intronic
968854882 4:3112353-3112375 GACCTGGGTGGCGGTTACAAGGG - Intronic
971241715 4:24895260-24895282 GCTCTGGGTGGTGGTTACACAGG + Intronic
971289493 4:25323818-25323840 GACTGTGGTGATGATTTCACGGG - Intronic
972090982 4:35283300-35283322 GATCATGGCGGTGGTTTCTCAGG + Intergenic
972593346 4:40508753-40508775 AATCTGGGTGGTGGTTCCACAGG + Intronic
972984823 4:44750539-44750561 TACCTAGGTGATGGGTTCACAGG - Intergenic
976900965 4:90175440-90175462 GATTGTGGTGATGGTTTCACAGG + Intronic
977697865 4:99986941-99986963 GATTGTGGTGATGGTTTCACAGG + Intergenic
977790881 4:101101719-101101741 GATCTGGGTAGTGGTTTCATGGG - Intronic
979488904 4:121301514-121301536 AGCCTAGGTGGTGATTTCACAGG + Intergenic
981071830 4:140548963-140548985 GATCATGGAGATGGTTTCACAGG - Intronic
981206810 4:142051469-142051491 GACTTGGGTGGTGGTTTCATCGG + Intronic
981807422 4:148732829-148732851 GACCTGGGTGTTGGTTACACAGG - Intergenic
982614330 4:157622032-157622054 GACCTGGGTGGTGGTTACAAAGG - Intergenic
983667834 4:170202108-170202130 GACCTGGGTTCTGGGTTCACAGG - Intergenic
983973431 4:173902102-173902124 GATCTTGGTGATGGTTTAAACGG + Intergenic
985332443 4:188853534-188853556 GATTGTGGTGGTTGTTTCACAGG - Intergenic
1202762930 4_GL000008v2_random:127292-127314 GAGGTTGGTGGTGGGTCCACCGG - Intergenic
986994138 5:13586873-13586895 TACCTCGGTGGTGGGTTGACAGG - Intergenic
987138682 5:14922847-14922869 GAACTCGGTGGTGGTTGCAGTGG + Intergenic
987144066 5:14974535-14974557 GACCTGGGTTGTGGTTGCTCAGG + Intergenic
987255854 5:16150080-16150102 GATCTGGGTGGTGGTGACACAGG + Intronic
987471225 5:18331067-18331089 TACCTAGGTGATGGTTTGACAGG - Intergenic
988378251 5:30467565-30467587 GATTATGGTGTTGGTTTCACAGG + Intergenic
988936541 5:36089012-36089034 GACTTCGGTGGTGGTTTTACAGG - Intergenic
988979454 5:36552061-36552083 GACTGTGGAGGTGGTTACACAGG + Intergenic
989227306 5:39044179-39044201 GATCTGGGTGCTGGTTTCACAGG + Intronic
990207151 5:53441847-53441869 GATGATGGTGTTGGTTTCACAGG + Intergenic
990607945 5:57429112-57429134 TACCTTGGTGATGGGTTGACAGG - Intergenic
991339839 5:65596719-65596741 GACCTTGGTGGAGGTTTAGAGGG - Intronic
992449922 5:76867170-76867192 GACTGTGGTGATGGTGTCACTGG - Intronic
995530270 5:113085331-113085353 GACATAGTTGGTGGTTTCCCTGG + Intronic
995983627 5:118140712-118140734 AATCTTGGTGGTGGTGTCAATGG - Intergenic
997138674 5:131354310-131354332 GACCTGGGTGGTAGCTACACAGG - Intronic
998042496 5:138960961-138960983 GATCTGGGTGGTGGTTACATGGG + Intronic
998389228 5:141776440-141776462 GACCTTGTTGCTGGTGGCACAGG - Intergenic
998649028 5:144096870-144096892 GATCTGGATGGTGGTTACACAGG - Intergenic
999058038 5:148602210-148602232 GAGTGTGGTGATGGTTTCACGGG + Intronic
999072521 5:148761160-148761182 GACCACAGTGTTGGTTTCACAGG + Intergenic
999215397 5:149929824-149929846 AATTTTGGTGGTGGTTTCATGGG + Intronic
999638362 5:153645970-153645992 GGCCTTGGGGTTGGTCTCACTGG + Intronic
1000025135 5:157352431-157352453 GCTGTTGGTGGTGGTGTCACAGG - Intronic
1001676343 5:173520158-173520180 GATCATGGTGATAGTTTCACAGG - Intergenic
1001847061 5:174931447-174931469 TACCTAGGTGATGGTTTGACAGG + Intergenic
1002120753 5:177002408-177002430 TACCTTGGTGGTACTTACACGGG + Intronic
1002627925 5:180545230-180545252 GATTGTGGTGATGGTTTCACGGG - Intronic
1003362092 6:5436982-5437004 GATTGTGGTGATGGTTTCACTGG - Intronic
1003570353 6:7252514-7252536 GATCTTGGTGTTGGGTGCACAGG + Intergenic
1003623144 6:7720098-7720120 TACCTGGGTGGTGGTTATACAGG - Intergenic
1004923223 6:20395942-20395964 GACCTGGGTGGTGGTTACAAAGG + Intergenic
1006745600 6:36339811-36339833 CATCTGGGTGGTGGTTACACAGG - Intergenic
1006791443 6:36703850-36703872 GACCTGGAGGGTGGTTACACAGG - Intronic
1006796889 6:36737655-36737677 GACCTTGGGGCTGGGTCCACAGG - Intergenic
1007508694 6:42358543-42358565 TCCCTTGGTGGAGTTTTCACAGG + Intronic
1008157902 6:48039519-48039541 AACCTTGGTGGTGTTTACATGGG + Intronic
1010207779 6:73338221-73338243 GATCGTGGTGATGGTTTCATGGG + Intergenic
1010674582 6:78726943-78726965 GAACTTGGTGATGGTTACATGGG - Intergenic
1011638530 6:89398257-89398279 GACTGTGCTGATGGTTTCACAGG + Intronic
1012181289 6:96156225-96156247 GACCATGGTGATAGTTGCACTGG - Intronic
1012517322 6:100077502-100077524 GACCTTGGTTTTTATTTCACTGG - Intergenic
1013386032 6:109632091-109632113 GACCTGGTTGGTGGTTACATGGG + Intronic
1013794600 6:113872993-113873015 GATTTTGGCGATGGTTTCACAGG - Intergenic
1013809037 6:114023921-114023943 GATTATGGTGATGGTTTCACAGG - Intergenic
1014994519 6:128125264-128125286 GATCATGGTGGTGGTTTCTCAGG + Intronic
1015073302 6:129123963-129123985 GACGGTGGTGATGGTTTCGCTGG + Intronic
1015291023 6:131538582-131538604 GACCCTGGTGGTGGAGGCACCGG - Intergenic
1016134253 6:140519654-140519676 GACCATGGTGATGGTTTCATGGG + Intergenic
1016306571 6:142690687-142690709 GATTTTAGTGATGGTTTCACAGG + Intergenic
1016982656 6:149866962-149866984 GATTGTGGTGATGGTTTCACTGG + Intergenic
1017403228 6:154088612-154088634 AATTATGGTGGTGGTTTCACAGG + Intronic
1017812114 6:157990842-157990864 GAGTTTGGAGGTGGTATCACTGG - Intronic
1018376232 6:163216280-163216302 GCCCTTGGTGCTGGCTCCACTGG - Intronic
1019231977 6:170574337-170574359 GACCTTGTTGGTGGCTGCAAGGG - Intergenic
1021332494 7:19356129-19356151 GATTATGGTGATGGTTTCACGGG - Intergenic
1021823927 7:24528284-24528306 GATTATGGTGATGGTTTCACAGG + Intergenic
1021826275 7:24555397-24555419 CACCTTGCTGGTGGTTACACAGG + Intergenic
1022948316 7:35310410-35310432 GACCTGGGAGATGGTTACACTGG + Intergenic
1023268188 7:38431120-38431142 GAGCTTTGTGGTGGTCTCATTGG - Intronic
1025603188 7:63018366-63018388 GATCATGGTGATGGTTCCACGGG + Intergenic
1026016458 7:66674851-66674873 GATCTAGGTGGTGGTTGGACGGG + Intronic
1026438448 7:70420835-70420857 GATCGTGGTGATGGCTTCACAGG + Intronic
1026512184 7:71036758-71036780 GACCTCGGTGGTGGTCACACAGG - Intergenic
1026539458 7:71267780-71267802 TACCTAGGTGATGGGTTCACAGG - Intronic
1027341321 7:77211112-77211134 GACCTGGGTGGTGGTTACTTGGG - Intronic
1028344447 7:89761773-89761795 GACCTTAGTGGTGGCTCCAGTGG - Intergenic
1028537076 7:91901576-91901598 AAATTGGGTGGTGGTTTCACTGG + Intergenic
1029138900 7:98395541-98395563 GATCTGGGTGGTGGTTACACAGG + Intronic
1029841502 7:103368947-103368969 GGATTTGGTGGTGGTTACACAGG - Exonic
1029918180 7:104233752-104233774 GATGGTGGTGATGGTTTCACAGG - Intergenic
1030707921 7:112714358-112714380 GCCTTTGGTGCTGGTTTCACAGG - Intergenic
1031212759 7:118851534-118851556 GATTATGGTGATGGTTTCACAGG + Intergenic
1031775094 7:125898989-125899011 GACTGTGGTGATGGTTTCACAGG - Intergenic
1032112097 7:129084866-129084888 GACTGTGGTCATGGTTTCACGGG - Intergenic
1034827481 7:154279423-154279445 ACCCTTGGTGGTGGTATCATGGG + Intronic
1035857166 8:2987975-2987997 TACCTAGGTGATGGGTTCACAGG - Intronic
1035878107 8:3213393-3213415 CACCTAGGTGGTGGTTTCATGGG - Intronic
1036782045 8:11656492-11656514 GATTGTGGTGATGGTTTCACGGG - Intergenic
1037530750 8:19770432-19770454 GATTGTGGTGATGGTTTCACGGG + Intergenic
1037596167 8:20356133-20356155 GATTGTGGTGATGGTTTCACAGG - Intergenic
1038457741 8:27688866-27688888 GACCTGGGTGAAGGTTACACAGG + Intergenic
1038555822 8:28514460-28514482 GACTGTGGTGATGGTTTCACAGG - Intronic
1038574867 8:28696298-28696320 GAGCTGGGTGCTGGGTTCACAGG - Intronic
1041000760 8:53449279-53449301 GATAGTGGTGGTGGTTGCACAGG + Intergenic
1042139588 8:65664493-65664515 GATCTAGGTGGTGGTTACAAAGG + Intronic
1042268084 8:66928797-66928819 GAATGTGGTGATGGTTTCACAGG - Intergenic
1042527357 8:69777477-69777499 GACTGTGGTGATGGCTTCACTGG + Intronic
1042769311 8:72362153-72362175 GACAGTAGTGATGGTTTCACAGG - Intergenic
1045513466 8:102834211-102834233 GACATTGGTGGAGGATTCACGGG - Exonic
1045843718 8:106608425-106608447 CATCTTGGTGGTGGTTTCTGTGG + Intronic
1046331044 8:112715388-112715410 GAACTTGATGTTGGTTTCTCAGG - Intronic
1047375860 8:124295314-124295336 GAATATGGTGATGGTTTCACAGG + Intergenic
1047591935 8:126336092-126336114 GAAATTGGTTGTGGTTTGACTGG + Intergenic
1047676103 8:127204935-127204957 GACTTAGGTAGTGGTTACACAGG + Intergenic
1051115235 9:13686797-13686819 GATCTAGGTGGTGCTTACACAGG + Intergenic
1052082415 9:24223513-24223535 CACCTGTGTGGTGGTTACACAGG + Intergenic
1053509406 9:38674848-38674870 GACCTAGGTGATGGTTACACAGG + Intergenic
1054747309 9:68867625-68867647 GATTGTGGTGATGGTTTCACAGG + Intronic
1054833435 9:69651325-69651347 GATCTGGGTGGTGGTTACACAGG + Intronic
1055028046 9:71743330-71743352 GACCTGGGTGGTGGCTACACAGG + Intronic
1055366619 9:75550798-75550820 GACCATGGGGGTGGTTTCTAAGG + Intergenic
1055468214 9:76586224-76586246 TATCTTGGTGGTGTTTACACAGG - Intergenic
1056849318 9:90068887-90068909 GATTGTGGTGATGGTTTCACAGG - Intergenic
1057838523 9:98466398-98466420 GACCTGGGTGGTAGTTACATGGG + Intronic
1057936682 9:99245762-99245784 GGCCTGAGTGGTGGTTACACAGG - Intergenic
1058725264 9:107797269-107797291 GACTGTGGTGATGGTTTCATGGG - Intergenic
1058850538 9:109007739-109007761 AAGCTTGGTGGTGGCTGCACAGG - Intronic
1059257530 9:112945038-112945060 GACCGTGGTGATGGTTTCAGGGG + Intergenic
1059865606 9:118510807-118510829 GATTTTGGTGGTGCTTACACAGG - Intergenic
1060439286 9:123623838-123623860 GACCCTGCTGTTGGTATCACAGG - Intronic
1060941738 9:127546448-127546470 AACATTGGTGGTGGGTTCTCAGG - Intronic
1061294993 9:129672136-129672158 GACCTTGGGGGTGATTTAAGGGG + Intronic
1061614206 9:131768789-131768811 GACCCTAGTGATGGTTTGACGGG + Intergenic
1062361663 9:136191154-136191176 GACCGTGGCGATGGTTGCACAGG - Intergenic
1203543693 Un_KI270743v1:112173-112195 GAGGTTGGTGGTGGGTCCACCGG - Intergenic
1186385771 X:9109035-9109057 GATTGTGGTGATGGTTTCACAGG - Intronic
1186521470 X:10210382-10210404 GTCCTGGGTGCTGGTTACACAGG - Intronic
1186661398 X:11671105-11671127 GATCGTGGTAGTGGTTTCATGGG - Intergenic
1187012438 X:15293833-15293855 GACATTTGGGTTGGTTTCACAGG + Intronic
1187491145 X:19752627-19752649 GGTCTGGGTGGTGGTTACACAGG + Intronic
1188702357 X:33280620-33280642 GATTGTGGTGATGGTTTCACAGG + Intronic
1189235341 X:39482659-39482681 GATCTGGGTGGTGGTTACATGGG + Intergenic
1189932529 X:46029405-46029427 GACCATGGTGATGGTATCACAGG - Intergenic
1189950722 X:46227845-46227867 GAATGTGGTGATGGTTTCACAGG + Intergenic
1191183914 X:57590564-57590586 GACCTTGGTCCTGGTTACACAGG + Intergenic
1192162202 X:68796805-68796827 GACCTTGGAGGTGTTGTCACAGG - Intergenic
1192221757 X:69202141-69202163 GACCTAGGTGGTGGTTACAGAGG - Intergenic
1193239562 X:79151437-79151459 GATTGTGGTGGTGGTTTCCCAGG - Intergenic
1193850121 X:86527278-86527300 GACTGTGGTGATGGTTTCATAGG - Intronic
1195034649 X:100961356-100961378 GACCTGGGTGGTGGTTACAAGGG + Intergenic
1195293425 X:103451302-103451324 GACTATGGTGTTGGTTTCATTGG - Intergenic
1196115246 X:111992268-111992290 GATTGTGGTGATGGTTTCACAGG + Intronic
1196567294 X:117223849-117223871 GATGGTGGTGATGGTTTCACTGG - Intergenic
1197006510 X:121508202-121508224 GATTTTGGTGGTGGATTCATGGG + Intergenic
1197180218 X:123527320-123527342 GATGGTCGTGGTGGTTTCACAGG - Intergenic
1198238707 X:134762368-134762390 GACCTGGGTGATGGTTACATGGG - Intronic
1198627501 X:138594238-138594260 GACCTAGGTGGTAGTGTCAGAGG + Intergenic
1198799718 X:140436375-140436397 GCCCTGGGTGCTGGTTTCATAGG + Intergenic
1198814217 X:140570166-140570188 GCCCTGGGTGTTGGTTACACAGG + Intergenic
1199212099 X:145224516-145224538 GATCGTGGTGGCGGTTTCATGGG + Intergenic
1199234068 X:145470978-145471000 GAGATTGTTGGTTGTTTCACAGG - Intergenic
1199419052 X:147621827-147621849 GACCGTGGTGATGGTTTCAGGGG + Intergenic
1199784596 X:151093120-151093142 GATAATGGTGATGGTTTCACAGG - Intergenic
1199880622 X:151971942-151971964 GATCTAGGTGTTGGTTACACGGG + Intronic
1199998307 X:153041203-153041225 GACTGTGGTGATGGGTTCACAGG - Intergenic
1200070451 X:153526450-153526472 GAACTTGGTGGTGCTTCCTCTGG + Intronic
1200388808 X:155921329-155921351 GATCTGGGTGGTGGTTACATGGG - Intronic