ID: 919368057

View in Genome Browser
Species Human (GRCh38)
Location 1:196690691-196690713
Sequence AGTGCACTCCACCAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 355
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 331}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919368057_919368063 -8 Left 919368057 1:196690691-196690713 CCCTGCCCCTGGTGGAGTGCACT 0: 1
1: 0
2: 0
3: 23
4: 331
Right 919368063 1:196690706-196690728 AGTGCACTGGATTTTATAAACGG 0: 1
1: 1
2: 3
3: 20
4: 210
919368057_919368064 0 Left 919368057 1:196690691-196690713 CCCTGCCCCTGGTGGAGTGCACT 0: 1
1: 0
2: 0
3: 23
4: 331
Right 919368064 1:196690714-196690736 GGATTTTATAAACGGTCTTGAGG 0: 1
1: 0
2: 2
3: 42
4: 255
919368057_919368066 24 Left 919368057 1:196690691-196690713 CCCTGCCCCTGGTGGAGTGCACT 0: 1
1: 0
2: 0
3: 23
4: 331
Right 919368066 1:196690738-196690760 AGCAGTGTCTGATTTACATAGGG 0: 6
1: 116
2: 251
3: 366
4: 542
919368057_919368065 23 Left 919368057 1:196690691-196690713 CCCTGCCCCTGGTGGAGTGCACT 0: 1
1: 0
2: 0
3: 23
4: 331
Right 919368065 1:196690737-196690759 AAGCAGTGTCTGATTTACATAGG 0: 7
1: 111
2: 257
3: 376
4: 540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919368057 Original CRISPR AGTGCACTCCACCAGGGGCA GGG (reversed) Intronic
900981874 1:6050322-6050344 AGTGCAGGCCACCTGGGCCATGG + Intronic
901374992 1:8831630-8831652 ATTGCACTCCAGCCTGGGCAAGG - Intergenic
902190464 1:14759392-14759414 AGTGCTCTCCAACAGGGGGTGGG - Intronic
902559668 1:17269653-17269675 ACTGCACTCCAGCCTGGGCATGG - Intronic
904007022 1:27368456-27368478 ATTGCACTCCAGCCTGGGCAGGG + Intergenic
904871159 1:33619122-33619144 AGGGCACTTGTCCAGGGGCAAGG + Intronic
905452034 1:38063102-38063124 TTTGCACTGCTCCAGGGGCAGGG + Intergenic
907470438 1:54670434-54670456 ACTGCAGGCCACCAGGGCCAAGG - Intronic
907533782 1:55128750-55128772 AGTGCACTCCACCCTGGCAACGG - Intronic
909081373 1:71116603-71116625 TGTGCAGCCCAGCAGGGGCATGG - Intergenic
909147774 1:71958915-71958937 ACTGCACTCCAGCCTGGGCAAGG + Intronic
909966061 1:81912107-81912129 ACTGCACTCCAGCGTGGGCAAGG - Intronic
911674738 1:100646802-100646824 AGTCCACACCACCAGGGCCTTGG + Intergenic
913977526 1:143474794-143474816 ACTGCACTCCAGCCTGGGCATGG + Intergenic
914071931 1:144300425-144300447 ACTGCACTCCAGCCTGGGCATGG + Intergenic
914107224 1:144665931-144665953 ACTGCACTCCAGCCTGGGCATGG - Intergenic
914761795 1:150605099-150605121 ACTGCACTCCAGCCTGGGCAGGG - Intronic
915383656 1:155469218-155469240 ATTGCACTCCAGCCTGGGCAAGG - Intronic
918438113 1:184537686-184537708 ATTGCACTCCAGCCTGGGCAAGG - Intronic
919368057 1:196690691-196690713 AGTGCACTCCACCAGGGGCAGGG - Intronic
920158371 1:203975295-203975317 ACTGCACTCCACCTGGGTGACGG - Intergenic
920297293 1:204966883-204966905 ATTGCACTCCACCAGTGCCGAGG + Intronic
922221523 1:223611987-223612009 TGTTCAGACCACCAGGGGCATGG + Intronic
922278108 1:224097905-224097927 ACTGCACTCCAGCCTGGGCAGGG + Intergenic
923613642 1:235518261-235518283 ACTGCACTCCAGCCTGGGCAAGG - Intergenic
924329862 1:242930715-242930737 ACTGCACTCCAGCCTGGGCAGGG + Intergenic
1062862788 10:823234-823256 AGCGCACACCAGCATGGGCACGG - Intronic
1064544618 10:16438041-16438063 ACTGCACTCCAGCCTGGGCAAGG - Intronic
1065951973 10:30660327-30660349 ACTGCACTCCAGCCTGGGCAAGG + Intergenic
1066017903 10:31266618-31266640 AGTGCACTCCCCATGGAGCAGGG + Intergenic
1066302101 10:34106223-34106245 ACTGCACTCCAGCCTGGGCAAGG + Intergenic
1068831852 10:61505205-61505227 TGAGCTCTCCACCAGGAGCAGGG + Intergenic
1068921350 10:62488221-62488243 ACTGCACTCCAGCCTGGGCAAGG - Intronic
1069216626 10:65829135-65829157 ACTGCACTCCAGCATGAGCATGG + Intergenic
1070310721 10:75271721-75271743 AGCGCACCCCACCAGGGCAAGGG - Intergenic
1071928739 10:90441115-90441137 TGGGCACTCCAACAGGGGCCTGG + Intergenic
1072506118 10:96069129-96069151 ACTGCACTCCAGCCTGGGCACGG + Intergenic
1073590095 10:104748813-104748835 ATTGCACTCCAGCCTGGGCAAGG + Intronic
1074853410 10:117456430-117456452 ACTGCACTCCAGCCTGGGCAAGG + Intergenic
1076091922 10:127693845-127693867 ACTGCACTCCAGCCTGGGCATGG + Intergenic
1076588462 10:131567321-131567343 TGTGGACTCCTCCAGGTGCAGGG - Intergenic
1076886920 10:133267261-133267283 TGTGCACTGCACCGGGGGCCAGG - Intronic
1077218028 11:1403184-1403206 AGGGCACTGCCCCAGGGGAAGGG - Intronic
1077315203 11:1916602-1916624 AGTGGACAGCACCAGGGGCAGGG + Intergenic
1077928576 11:6707166-6707188 AGAGCTCTCCACCAGGTTCAGGG - Intergenic
1079781452 11:24610905-24610927 ATTGCACTCCAGCATGGGCTAGG + Intronic
1080444117 11:32321912-32321934 ATTGCACTCCAGCCTGGGCAAGG + Intergenic
1081196374 11:40165905-40165927 ATTGCACTCCAGCCCGGGCAAGG + Intronic
1081393826 11:42561688-42561710 ACTGCACTCCAGCCTGGGCAAGG - Intergenic
1082025377 11:47567596-47567618 ATTGCACTCCAGCCTGGGCAAGG - Intronic
1082029310 11:47593490-47593512 GGTGCACCCCACCAGTGCCAAGG + Intronic
1083780132 11:64913465-64913487 AGTGCTCTGCTCTAGGGGCACGG + Intronic
1085942598 11:81222801-81222823 AGTCCACGCCACCAGGGTCTAGG - Intergenic
1086733936 11:90282969-90282991 AGGGCACTACACCATTGGCAAGG + Intergenic
1086878364 11:92125151-92125173 AGTTCAGCCTACCAGGGGCAAGG + Intergenic
1088894193 11:114065452-114065474 ATTGCACTCCAGCCTGGGCAAGG - Intronic
1089392850 11:118113819-118113841 TTTGCTCTCCTCCAGGGGCAGGG + Intronic
1089613000 11:119679974-119679996 TGTGAACTCCTCCAAGGGCAGGG + Intronic
1089967572 11:122666000-122666022 AGTGAACTCCACCAGGACCAAGG + Intronic
1090234217 11:125134604-125134626 GGTGCTCTTCACCAGGGGAATGG - Intergenic
1090509559 11:127360522-127360544 ATTGCACTCCAGCCTGGGCAAGG - Intergenic
1090948105 11:131449315-131449337 GGTGGACTCCCACAGGGGCATGG + Intronic
1094589824 12:31809758-31809780 ACTGCACTCCATCCTGGGCAAGG - Intergenic
1095910773 12:47424460-47424482 TGAGCATTCCACCAGGGGCTGGG + Intergenic
1096127281 12:49129280-49129302 AGGGCACTACACCATTGGCAAGG - Exonic
1096134216 12:49186348-49186370 AGGGCACTACACCATTGGCAAGG - Exonic
1096144684 12:49269916-49269938 AGGGCACTACACCATTGGCAAGG + Exonic
1096216681 12:49801649-49801671 AGTGCTCCCCACCAGCGGGAGGG - Intronic
1097299523 12:58003483-58003505 ACTGCACTCCAGCCTGGGCAAGG - Intergenic
1099447306 12:82767546-82767568 ACTGCACTCCAGCTTGGGCATGG + Intronic
1099487892 12:83250258-83250280 ATTACACTACACCAGGGGGATGG - Intergenic
1100992393 12:100265555-100265577 ATTGCACTCCAGCCTGGGCAAGG + Intronic
1101251293 12:102938827-102938849 AGTGCAGTGTAGCAGGGGCAAGG - Intronic
1101656978 12:106730960-106730982 AATGCACTCCAGCCTGGGCAAGG + Intronic
1102050710 12:109860014-109860036 ATTGCACTCCAGCTTGGGCAAGG - Intronic
1104366535 12:128183177-128183199 ACTGCACTCCAGCCTGGGCAAGG - Intergenic
1104565921 12:129883025-129883047 AGTGCAATACACAAGGGACAGGG + Intronic
1104896864 12:132168965-132168987 AGTGCACTCCGCCAGAGGGCCGG - Intergenic
1105221808 13:18336598-18336620 ACTGCACTCCAGCCTGGGCATGG - Intergenic
1105518263 13:21109778-21109800 ACTGCACTCCAGCCTGGGCAAGG - Intergenic
1105862722 13:24430614-24430636 ACTGCACTCCAGCCTGGGCAAGG + Intronic
1106584392 13:31044292-31044314 ACTGCCCTCCACCAGGAGCCAGG + Intergenic
1106722676 13:32452097-32452119 ATTGCACTCCAGCCTGGGCAAGG - Intronic
1107579892 13:41771926-41771948 ATTGCACTCCACCCTGGGCCAGG - Intronic
1108122176 13:47201227-47201249 ACTGCACTCCACCTGGGCGACGG - Intergenic
1110301297 13:73930899-73930921 ATTGCACTCCAGCCTGGGCAAGG - Intronic
1111176800 13:84606185-84606207 AGAGCATTCCACCAGGTGCCTGG - Intergenic
1111259965 13:85724546-85724568 AGTCCACACCACCAGGGCCTTGG + Intergenic
1112507746 13:99985236-99985258 GGTGCTCTCCCCCAGGGGCCCGG + Intronic
1113449129 13:110393839-110393861 ACTGCACTCCAGCCTGGGCAAGG + Intronic
1114444403 14:22777104-22777126 ACTGCACTCCAGCCTGGGCAAGG + Intronic
1114519793 14:23325917-23325939 AGTGCATTTCCCCAGGGGGAAGG - Exonic
1115325005 14:32128369-32128391 ACTGCACTCCAGCATGGGCTGGG + Intronic
1116490991 14:45502958-45502980 ACTCCAGTACACCAGGGGCAGGG + Intergenic
1117151907 14:52897936-52897958 ATTGCACTCCAGCCTGGGCAAGG + Intronic
1117389152 14:55246841-55246863 ATTGCACTCCAGCCTGGGCATGG - Intergenic
1117503175 14:56374493-56374515 AGCCCACTCCACCAGGGCCTTGG - Intergenic
1117707594 14:58487566-58487588 ATTGCACTCCACCCTGGGCAAGG + Intronic
1117720907 14:58627932-58627954 AGTGAAATCCCCCAGGTGCACGG + Intergenic
1119747924 14:77057698-77057720 ACTGCACTCCAGCCCGGGCAAGG - Intergenic
1120612357 14:86657939-86657961 GGTGAACTCCACCATGGGAATGG - Intergenic
1120740706 14:88106059-88106081 TGAGCATTCCACCAGGGGCCTGG - Intergenic
1121247096 14:92469469-92469491 ACTGCACTCCAGCCTGGGCACGG + Intronic
1122216139 14:100205927-100205949 ACTGCACTCCAGCCTGGGCATGG - Intergenic
1122767455 14:104082015-104082037 AGGGCTCCCCACCAGGGGCTGGG - Intergenic
1122918402 14:104869299-104869321 AGTGCCATCCACCTGGGTCAGGG - Intronic
1124529823 15:30495861-30495883 AGTGCCCTCAACCAAGGGCTTGG - Intergenic
1124768836 15:32511827-32511849 AGTGCCCTCAACCAAGGGCTTGG + Intergenic
1127260846 15:57325109-57325131 ACTGCACTCCAACCTGGGCAAGG - Intergenic
1129228122 15:74181586-74181608 TGTGCACCCCACCCTGGGCAAGG + Intronic
1129541899 15:76356771-76356793 AGAGCACTGCACCAACGGCAGGG + Intronic
1129919645 15:79309568-79309590 AGAGCACTCCACCTGTGCCAGGG + Intergenic
1132956482 16:2596982-2597004 TGTGCACTCACCCAGGGGCAGGG - Intronic
1133300886 16:4781986-4782008 ACTGCACTCCAGCCTGGGCAAGG - Intronic
1135099522 16:19593949-19593971 AATGCACCCAACCAAGGGCAAGG - Intronic
1135566311 16:23513745-23513767 ACTGCACTCCAGCCTGGGCACGG + Intronic
1135616531 16:23915362-23915384 AGTTCACTCCTTCCGGGGCAAGG - Intronic
1136504101 16:30691655-30691677 ACTGCACTCCAGCCTGGGCAAGG + Intergenic
1138267914 16:55673262-55673284 AGTGCATTCCATCAGGGGGTGGG + Intronic
1138413975 16:56860685-56860707 ACTGCACTCAGCCAGGGGCGAGG + Intergenic
1139690987 16:68641955-68641977 ATTGCACTCCAGCCTGGGCATGG + Intronic
1140122054 16:72092373-72092395 ACTGCACTCCAGCCTGGGCAAGG + Intronic
1140420931 16:74818113-74818135 TGTGCACTCAGCTAGGGGCATGG - Intergenic
1141678440 16:85530005-85530027 TGTGCACTGCACAAGGGGCTGGG - Intergenic
1142645553 17:1312027-1312049 ATTGCACTCCAGCCTGGGCAAGG - Intergenic
1143726475 17:8850265-8850287 ATTGCACTCCAGCCTGGGCAAGG + Intronic
1144059700 17:11571626-11571648 ACTGCACTCCAGCCTGGGCAAGG + Intergenic
1144774770 17:17779810-17779832 ACTGCACTCCAGCCTGGGCAAGG - Intronic
1145085846 17:19938771-19938793 ACTGTACTCCACCCTGGGCAGGG - Intronic
1146279940 17:31538353-31538375 GGTGCTGTCCCCCAGGGGCAGGG + Intergenic
1146657883 17:34645678-34645700 ATTGCACCCCACCAGGGGAGGGG - Intergenic
1147354888 17:39887221-39887243 ACTGCACTCCAGCCTGGGCAAGG - Intergenic
1147589023 17:41669339-41669361 ACTGCACTCCAGCCTGGGCAAGG + Intergenic
1148840117 17:50489952-50489974 ACTGCACTCCAGCCTGGGCAAGG - Intergenic
1149475684 17:56959304-56959326 ACTGCACTCCAGCCTGGGCATGG + Intronic
1149585770 17:57785311-57785333 AGCACACTCCACCAATGGCAAGG - Intergenic
1152380676 17:79940985-79941007 GGTGCACTCCACCGCGGGCATGG + Exonic
1153667425 18:7378870-7378892 ATTGCACTCCAGCCTGGGCAAGG - Intergenic
1153864539 18:9251754-9251776 ACTGCACTCCACCTGGGCGACGG + Intronic
1154935676 18:21053690-21053712 AGTGCATGCCACCATGGGCCTGG - Intronic
1157096925 18:44694247-44694269 ACTGCACTCCAGCCTGGGCAAGG - Intronic
1158168122 18:54565044-54565066 ACTGCACTCCAGCATGGGGACGG - Intergenic
1158987844 18:62836917-62836939 ACTGCACTCCAGCCTGGGCAAGG + Intronic
1160206749 18:76840974-76840996 ACTGCACTCCAGCCTGGGCATGG - Intronic
1160835733 19:1123693-1123715 ACTGGGCTCCCCCAGGGGCAGGG + Intronic
1161405896 19:4090925-4090947 GCTGCACTCCACCTGGGGCGGGG + Intronic
1162110000 19:8394890-8394912 AGTGCACTCCAGCCTGGGCGAGG + Intronic
1162202566 19:9031659-9031681 ATTGCACTCCAGCCTGGGCAAGG - Intergenic
1162439410 19:10683317-10683339 AGTGCCTCCCTCCAGGGGCAGGG - Intronic
1162709204 19:12579213-12579235 ACTGCACTCCAGCCTGGGCAAGG + Exonic
1162750841 19:12828543-12828565 AGTGGCCTCCAACAGGGCCAAGG - Intronic
1162920344 19:13898059-13898081 ACTGCACTCCAGCCTGGGCAAGG + Intronic
1163160712 19:15462446-15462468 ACTGCACTCCAGCCTGGGCAAGG + Intronic
1163652023 19:18523345-18523367 ACTGCACTCCAGCCTGGGCAAGG - Intergenic
1164992294 19:32692840-32692862 AGAGCACTTCACCAAGAGCATGG - Intronic
1166362310 19:42258342-42258364 ACTGCACTCCAGCCTGGGCAAGG - Intergenic
1166459350 19:42972585-42972607 TCTGCACTCCATCCGGGGCATGG + Intronic
1167257505 19:48439903-48439925 ATTGCACTCCAGCCTGGGCAGGG + Intronic
1167358093 19:49016260-49016282 GGTGCACACCACCTGAGGCAGGG + Exonic
926195433 2:10761071-10761093 AGTTCAGGCCAGCAGGGGCAGGG + Intronic
927890592 2:26745658-26745680 ACTGCACTCCAGCCTGGGCAAGG + Intergenic
928540723 2:32281277-32281299 ACTGCACTCCACCCTAGGCAAGG - Intronic
928972837 2:37049926-37049948 ATTGCACTCCAGCCTGGGCAAGG - Intronic
929083300 2:38142822-38142844 AGTTCACACCACCAGCTGCAGGG - Intergenic
929245589 2:39699061-39699083 ACTGCACTCCAGCATGGGCAAGG - Intronic
929600008 2:43199035-43199057 ACTGCACTCCAGCCTGGGCAAGG - Intergenic
930475621 2:51877435-51877457 ATTGCACTCCAGCCTGGGCAAGG - Intergenic
931967811 2:67552718-67552740 ACTGCACTCCAGCCTGGGCACGG + Intergenic
933755113 2:85632381-85632403 ACTGCACTCCAGCTGGGGAACGG + Intronic
934182232 2:89635790-89635812 ACTGCACTCCAGCCTGGGCATGG + Intergenic
934292528 2:91709999-91710021 ACTGCACTCCAGCCTGGGCATGG + Intergenic
935006083 2:99078231-99078253 ACTGCACTCCAGCCTGGGCAAGG + Intronic
935167677 2:100583447-100583469 ACTGCACTCCAGCCTGGGCACGG + Intergenic
936516419 2:113184296-113184318 AGTCCTCTCCACCATGGGCCAGG + Intronic
937976705 2:127586875-127586897 AGAGCTCCCCACCAGGGGCAGGG - Intronic
939364908 2:141219102-141219124 AGTCCACCCCACCAGGGCCTTGG + Intronic
939976308 2:148720610-148720632 AGTCCACGCCACCAGGGCCTTGG - Intronic
944439449 2:199727388-199727410 AGTCCACACCACCAGGGCCTTGG - Intergenic
946258699 2:218467195-218467217 ACTGCACTCCAGCCTGGGCAGGG - Intronic
946614469 2:221494787-221494809 ACTGCATTCCAGAAGGGGCAGGG + Intronic
948609039 2:239155265-239155287 GGTCCACTCCACCTGGGACATGG + Intronic
948921418 2:241067704-241067726 CCTGCACTCCCCCAGGAGCAAGG + Intronic
949058780 2:241944493-241944515 AATGCACTCCACGTGGGGTAGGG - Intergenic
1169159971 20:3369089-3369111 ATTGCACTCCAGCCTGGGCAAGG + Intronic
1171475606 20:25406426-25406448 ACTGCACTCCACCTGGGTAACGG + Intergenic
1171867259 20:30496789-30496811 ACTGCACTCCAGCCGGGGCGGGG + Intergenic
1171871609 20:30531342-30531364 ATTGCACTCCAGCCTGGGCATGG + Intergenic
1171907971 20:30915717-30915739 ACTGCACTCCAGCCGGGGCGGGG - Intergenic
1172420912 20:34816762-34816784 ACTGCACTCCAGCCTGGGCAAGG + Intronic
1172477179 20:35247746-35247768 AGAGCCCTCCAACAGGAGCATGG + Intronic
1172478269 20:35254911-35254933 CGTTCAATCCACCAGGGCCAGGG + Intronic
1174960284 20:55148626-55148648 ATAGCTCTCCACCATGGGCAAGG + Intergenic
1176730241 21:10487448-10487470 ACTGCACTCCAGCCTGGGCATGG - Intergenic
1177151154 21:17456989-17457011 ACTGCACTCCAGCCTGGGCAAGG - Intergenic
1178296075 21:31411511-31411533 ATTGCACTCCAGCCTGGGCAAGG - Intronic
1178451507 21:32705688-32705710 AGTGAACACCAACAGGGGCCTGG + Intronic
1179979874 21:44890301-44890323 GGTGTTCTCCACCAAGGGCAAGG - Intronic
1180341410 22:11621877-11621899 ACTGCACTCCAGCCGGGGCGGGG - Intergenic
1180943409 22:19675521-19675543 ACTGCACTCCAGCCTGGGCAAGG - Intergenic
1181696363 22:24594759-24594781 CGTGCCCTCCCCCAGGGCCAAGG + Intronic
1183503112 22:38193064-38193086 ACTGCACTCCAGCCTGGGCAAGG + Intronic
1183723778 22:39577371-39577393 AGGGGTCTCCACCAGGTGCATGG - Intronic
1183892020 22:40937292-40937314 ATTGCACTCCAGCCTGGGCAAGG + Intergenic
1184456880 22:44615982-44616004 AGAGCACTCAGCCAGGGGCCCGG + Intergenic
1184499001 22:44860704-44860726 TGTGCTCTCCCCCTGGGGCAGGG + Intronic
1184693446 22:46127697-46127719 AGGAGGCTCCACCAGGGGCAGGG - Intergenic
949474390 3:4429870-4429892 AGAACACTGCACCAGTGGCAAGG + Intronic
950476068 3:13215694-13215716 ACTGCACTCCACCCCTGGCACGG + Intergenic
952207636 3:31196365-31196387 AGTGAACTTCACCAGAGGAAAGG + Intergenic
952721009 3:36532652-36532674 AGTGCAGTCTTCCAGGGGTAGGG - Intronic
954363440 3:50134294-50134316 AGTCCACTCCACCTGGGGAAGGG + Intergenic
954687826 3:52380156-52380178 AGAGGACCCCACCAGGGGCAGGG - Intronic
955323355 3:57990909-57990931 ACTGCACTCCAACATGGGCAAGG - Intergenic
956893995 3:73641002-73641024 ACTGCACTCCAGCCTGGGCAAGG + Intergenic
958006202 3:87814091-87814113 AGTGCATACCACCAGGCACAAGG - Intergenic
958759716 3:98292377-98292399 AGCCCACTCCACCAGGGTCTTGG - Intergenic
959587562 3:108039331-108039353 AGTGCACTCGCCCATCGGCATGG - Intergenic
960502627 3:118455414-118455436 AGCCCACTCCACCAGGGCCTTGG - Intergenic
960766068 3:121131953-121131975 ATGGCACTGCACCAGGAGCAAGG - Intronic
960766491 3:121135967-121135989 AGTTCATTCCACCATGGCCATGG - Intronic
961010488 3:123432566-123432588 ACTGCACTCCAGCCTGGGCACGG - Intronic
961123935 3:124398927-124398949 AGGGCACTGCCCCAGGGGCAGGG + Intronic
963477995 3:145831186-145831208 ACTGCACTCCAGCCTGGGCAAGG + Intergenic
968431587 4:562237-562259 TCTGCACTCCATCAGGGGCCTGG - Intergenic
968433941 4:575607-575629 CTTGCGCTCCACCAGGGACACGG + Intergenic
968753888 4:2404901-2404923 ACTGCACTCCAGCCTGGGCAAGG - Intronic
968830667 4:2931681-2931703 AGTGCAGGGCACCCGGGGCAGGG + Intronic
968856211 4:3125704-3125726 CGTGCTGTCCACCAGGTGCAGGG - Intronic
968914613 4:3491993-3492015 AGTCCCCTCCTCCTGGGGCAGGG - Intronic
969599064 4:8165229-8165251 ATTGGACCCCACAAGGGGCATGG + Intergenic
969697715 4:8744552-8744574 ACTGCACTCCACCAGGCGGCGGG + Intergenic
970675305 4:18442237-18442259 AGTGCACTCCACCAAGGTAGTGG + Intergenic
970858704 4:20677534-20677556 GGTGCACTCTACCAGGGTCTTGG + Intergenic
971994997 4:33954595-33954617 AGGGGACTCCACCAAGGACAGGG - Intergenic
975555631 4:75662258-75662280 ATTGCACTCCAGCCTGGGCAAGG - Intronic
975958823 4:79875765-79875787 ATTTCACTCTACCAGGAGCATGG - Intergenic
976078052 4:81321488-81321510 AGTCCACACCACCAGGGCCTTGG + Intergenic
980589788 4:134870545-134870567 ACTGCACTCCAGCCTGGGCAAGG + Intergenic
983541834 4:168919486-168919508 ACTGCACTCCAGCCTGGGCAAGG + Intronic
983794893 4:171850001-171850023 ATTGCACTCCAGCCTGGGCATGG - Intronic
985832222 5:2242279-2242301 AGAGCCCCTCACCAGGGGCACGG - Intergenic
986331751 5:6721594-6721616 AGTGCACACCACCAGAGTCCAGG - Intronic
987339071 5:16923322-16923344 ACTGCACTCCACCTGGGCGACGG - Intronic
988179150 5:27767037-27767059 ATTGCACTCCAGCCTGGGCAAGG - Intergenic
989043103 5:37249239-37249261 AGTTACCTCCGCCAGGGGCAGGG + Exonic
990225445 5:53647248-53647270 ACTGCACTCCAGCCTGGGCAAGG - Intronic
990585978 5:57211619-57211641 ATTGCACTCCAGCCTGGGCAAGG - Intronic
991363100 5:65841550-65841572 AGCCCACTCCATCAGAGGCAGGG - Intronic
992268100 5:75037838-75037860 AGTGCACTCCAGCCTGGGCAAGG + Intergenic
992343040 5:75845939-75845961 ACTGCACTCCACCTGGGCGACGG - Intergenic
992680239 5:79145703-79145725 AGTACAATCCACCATGGCCAGGG + Intronic
993417907 5:87658141-87658163 ATTGCACTCCACCCTGGGCGAGG + Intergenic
996195846 5:120605992-120606014 AGTGCACACCAACAGAGGCAGGG + Intronic
996740153 5:126791493-126791515 ACTGCACTCCAGCCTGGGCAAGG - Intronic
996783394 5:127212939-127212961 TTTGAACTCCACCAGAGGCATGG + Intergenic
997308038 5:132855155-132855177 ATTGCACTCCAGCCTGGGCAAGG - Intergenic
997508209 5:134435075-134435097 ATTGCACTCCAGCCTGGGCAAGG + Intergenic
998938169 5:147252841-147252863 AGTGAACTCCATGAGGGCCAGGG + Intronic
999153718 5:149443076-149443098 AGTCCCCGCCACCAGGGGCATGG + Intergenic
999666447 5:153917596-153917618 AGCCCACTCCACCAGGGCCTTGG - Intergenic
999743076 5:154571717-154571739 AGTGAACCCCACGAGGGGAAGGG + Intergenic
1000079209 5:157829062-157829084 ATTGCACTCCAGCCTGGGCATGG + Intronic
1001921249 5:175601786-175601808 ATTGCACTCCAGCCTGGGCAAGG - Intergenic
1001962083 5:175885611-175885633 AGTGCACTAACCCAGGGGTATGG - Intergenic
1002208310 5:177579590-177579612 ATTGCACTCCAGCCTGGGCAAGG - Intergenic
1002334277 5:178467308-178467330 AAGGGTCTCCACCAGGGGCAGGG - Intronic
1002370090 5:178745108-178745130 TTTGAACTCCACCAGAGGCATGG - Intergenic
1002617124 5:180462892-180462914 AGTGCACTCCATCCTGGGCAAGG - Intergenic
1005406913 6:25499058-25499080 AGAGAACTCCAGCAGTGGCATGG - Intronic
1005807935 6:29492424-29492446 ACTGCACTCCAGCCTGGGCAGGG + Intergenic
1008016773 6:46529358-46529380 AGTGCTGTCCACCAGGAGGATGG - Intergenic
1010452601 6:76019562-76019584 ACTCCCCTCCACCATGGGCATGG + Intronic
1012479159 6:99649159-99649181 ATTGCACTCCAGCCTGGGCAAGG - Intergenic
1017074267 6:150602776-150602798 AGTGCAGTTCAAGAGGGGCAGGG - Intronic
1018069390 6:160148882-160148904 ACTGCACTCCAGCCCGGGCAGGG + Intronic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019335252 7:479743-479765 AGTCCACAGCACCAGGGGCTGGG + Intergenic
1019448651 7:1084582-1084604 GGAGCGGTCCACCAGGGGCAAGG - Intronic
1019684561 7:2373863-2373885 AGTGCACCCTGGCAGGGGCAGGG - Intronic
1020084811 7:5304385-5304407 AGTGCAGTCCCTGAGGGGCAGGG - Exonic
1020177607 7:5895662-5895684 ACTGCACTCCAGCAGCGGGATGG - Intergenic
1020312813 7:6882178-6882200 ATTGCACTCCAGCCTGGGCAAGG - Intergenic
1020499034 7:8891991-8892013 ACTGCACTCCAGCCAGGGCAAGG - Intergenic
1020990925 7:15195362-15195384 TGTGCACTTTACCAGGGGCACGG - Intergenic
1021502891 7:21349604-21349626 ACTGCACTCCAGCCTGGGCAAGG - Intergenic
1025209498 7:57012819-57012841 AGTGCAGTCCCCAAGGGGCAGGG + Intergenic
1025261755 7:57424914-57424936 AGCGCGCTCGCCCAGGGGCAGGG - Intergenic
1025662449 7:63564031-63564053 AGTGCAGTCCCCAAGGGGCAGGG - Intergenic
1026290064 7:68998165-68998187 ACTGCACTCCAGCATGGGCAGGG - Intergenic
1026805275 7:73425475-73425497 ACTGCACTCCAGCCTGGGCATGG - Intergenic
1027411576 7:77925545-77925567 ACTGCACTCCAGCCTGGGCAAGG - Intronic
1027486398 7:78767025-78767047 ATTGCACTCCAGCCTGGGCAAGG - Intronic
1027917840 7:84348944-84348966 ACTGCACTCCAGCCTGGGCAAGG + Intronic
1028178101 7:87680755-87680777 ATTGCACTCCAGCTTGGGCAAGG + Intronic
1028533962 7:91870798-91870820 ACTGAACTCCAGCATGGGCAAGG - Intronic
1028595925 7:92546459-92546481 ATTGCACTCCAGCCTGGGCAAGG - Intergenic
1032168703 7:129566271-129566293 ATAGCACTCCACCCTGGGCAGGG + Intergenic
1032182297 7:129690720-129690742 AGTGCTCCCAACCAAGGGCATGG + Intronic
1032255773 7:130295939-130295961 ATTGCACTCCAGCCTGGGCAAGG + Intronic
1032394742 7:131581414-131581436 GGTGCCCACCACCGGGGGCAGGG - Intergenic
1032590687 7:133189603-133189625 ACTGCACACCACCAGTAGCAGGG + Intergenic
1033983747 7:147197337-147197359 AGTACACTCCACGGGGGGCGGGG - Intronic
1034599331 7:152234095-152234117 ACTGCACTCCAGCCTGGGCATGG + Intronic
1037059147 8:14485272-14485294 ACTGCATTCCAGCGGGGGCAGGG - Intronic
1037444005 8:18946541-18946563 ACTGCACTCCAGCCTGGGCATGG + Intronic
1037943636 8:22973264-22973286 ACTGCACTCCAGCTTGGGCAAGG - Intronic
1039404617 8:37301840-37301862 AGTGCGCTCCATCAGGGGTGGGG + Intergenic
1040561463 8:48526530-48526552 TGTGTACTACACCAGGGGCTGGG + Intergenic
1041014252 8:53575332-53575354 ATTGCACTCCAGCCTGGGCATGG - Intergenic
1042928692 8:73992669-73992691 AGTGCAACCCACCAGGAGAAGGG - Intronic
1044023973 8:87144780-87144802 ATTGCACTCCAGCCTGGGCAAGG + Intronic
1044984222 8:97743732-97743754 ACTGCACTCCAGCCTGGGCATGG + Intergenic
1047020622 8:120771905-120771927 ACTGCACTCCAGCCTGGGCAAGG - Intronic
1052492953 9:29189700-29189722 ACTGCACTCCAGCCTGGGCACGG + Intergenic
1052812987 9:33077452-33077474 ATTGCACTCCAGCCTGGGCAAGG + Intergenic
1052870161 9:33497892-33497914 AATGCACTCCACCTGGGCAACGG + Intergenic
1053301857 9:36958123-36958145 AGTGCATTTCTGCAGGGGCAGGG - Intronic
1053397658 9:37788777-37788799 AGTGAACTCCCCCAAGGGCAGGG - Intronic
1053678673 9:40464631-40464653 AGTCCACACCACCAGGGCCTTGG + Intergenic
1053839853 9:42182070-42182092 AGTCCACACCACCAGGGCCTTGG + Intergenic
1054118314 9:61188445-61188467 AGTCCACACCACCAGGGCCTTGG + Intergenic
1054291751 9:63300169-63300191 AGTCCACACCACCAGGGCCTTGG + Intergenic
1054505945 9:65911664-65911686 AGTCCACACCACCAGGGCCTTGG - Intergenic
1054589441 9:66994119-66994141 AGTCCACACCACCAGGGCCTTGG - Intergenic
1055097036 9:72424250-72424272 AGTGAAATCCACCAGAGGAAGGG - Intergenic
1055307917 9:74950075-74950097 ACTGCACTCCAGCCTGGGCATGG + Intronic
1056267526 9:84914482-84914504 ACAGCACTCCACCAGGGGAAAGG + Intronic
1056399214 9:86210372-86210394 ACTGCACTCCACCTGGGCAACGG + Intergenic
1056617664 9:88182149-88182171 ATTGCACTCCAGTCGGGGCAAGG + Intergenic
1056828209 9:89891358-89891380 AGTGCCCTCCCGCAGGGACAGGG + Intergenic
1057109961 9:92460102-92460124 ACTGCACTCCAGCCTGGGCATGG - Intronic
1057248777 9:93482223-93482245 ACTGCACTCCAACCTGGGCAAGG - Intronic
1057659876 9:96991291-96991313 AGTGCACTCCAGCCTGGGCAAGG + Intronic
1057920531 9:99093232-99093254 AGTGCTCAACACCAGGGGTAGGG - Intergenic
1059008197 9:110427258-110427280 AATGCACTCCAGCCTGGGCAAGG + Intronic
1059178924 9:112193425-112193447 ACTGCACTCCAGCCTGGGCACGG - Intergenic
1060074117 9:120576662-120576684 ACTGCACTCCAGCCTGGGCAAGG + Intronic
1060519103 9:124283812-124283834 CGTGCAGTCTACCTGGGGCATGG - Intronic
1060962925 9:127693938-127693960 ATTGCACTCCAGCCTGGGCAAGG - Intronic
1061096768 9:128462187-128462209 ACTGCACTCCAGCCTGGGCAAGG - Intronic
1061397207 9:130349630-130349652 GGTCCACTCCACCTGGGGCGTGG - Intronic
1061898688 9:133662085-133662107 AGTGCCCTCCCCGAGGGGCCAGG + Intergenic
1062413316 9:136435382-136435404 ACTGCACTCCAGCCTGGGCACGG - Intronic
1062456527 9:136642100-136642122 ACTGCACTCCAGCCTGGGCAAGG - Intergenic
1203584038 Un_KI270746v1:46625-46647 ACTGCACTCCAGCCTGGGCATGG + Intergenic
1185633213 X:1531725-1531747 AGTGCCCTGCTCCAGGGGAAAGG - Intronic
1186185926 X:7019718-7019740 TCTGCACTCCATCCGGGGCATGG + Intergenic
1190746863 X:53329057-53329079 AGTGAACTCCACCACGGCCCTGG - Intergenic
1194009470 X:88541702-88541724 AGGGCATTCCACAAAGGGCAGGG + Intergenic
1196411590 X:115425437-115425459 AGGGCACTACACCATTGGCAAGG - Intergenic
1196833138 X:119791806-119791828 AGTGCGTTCCCCCAGGGGCCCGG + Intergenic
1197193763 X:123677831-123677853 ACTGCACTCCAGCATGGGCAAGG + Intronic
1197740933 X:129893404-129893426 ACTGCACTCCAGCCTGGGCAGGG - Intergenic
1199652152 X:149956384-149956406 ACTGCACTCCAGCCTGGGCATGG - Intergenic
1201227218 Y:11829833-11829855 ACTGCACTCCAGCCTGGGCAGGG + Intergenic