ID: 919369789

View in Genome Browser
Species Human (GRCh38)
Location 1:196708702-196708724
Sequence CTCTGTTAGGGCAAGCCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 284}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919369778_919369789 20 Left 919369778 1:196708659-196708681 CCCCCTTGGTACATGTTTATTTG 0: 1
1: 0
2: 1
3: 38
4: 448
Right 919369789 1:196708702-196708724 CTCTGTTAGGGCAAGCCCACTGG 0: 1
1: 0
2: 2
3: 12
4: 284
919369779_919369789 19 Left 919369779 1:196708660-196708682 CCCCTTGGTACATGTTTATTTGT 0: 1
1: 0
2: 2
3: 30
4: 373
Right 919369789 1:196708702-196708724 CTCTGTTAGGGCAAGCCCACTGG 0: 1
1: 0
2: 2
3: 12
4: 284
919369780_919369789 18 Left 919369780 1:196708661-196708683 CCCTTGGTACATGTTTATTTGTG 0: 1
1: 0
2: 1
3: 26
4: 370
Right 919369789 1:196708702-196708724 CTCTGTTAGGGCAAGCCCACTGG 0: 1
1: 0
2: 2
3: 12
4: 284
919369777_919369789 28 Left 919369777 1:196708651-196708673 CCTGTGTGCCCCCTTGGTACATG 0: 1
1: 0
2: 0
3: 5
4: 80
Right 919369789 1:196708702-196708724 CTCTGTTAGGGCAAGCCCACTGG 0: 1
1: 0
2: 2
3: 12
4: 284
919369781_919369789 17 Left 919369781 1:196708662-196708684 CCTTGGTACATGTTTATTTGTGG 0: 1
1: 0
2: 0
3: 38
4: 498
Right 919369789 1:196708702-196708724 CTCTGTTAGGGCAAGCCCACTGG 0: 1
1: 0
2: 2
3: 12
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919369789 Original CRISPR CTCTGTTAGGGCAAGCCCAC TGG Intronic
900351851 1:2238747-2238769 CTCGGTGAGTGCCAGCCCACAGG - Intronic
903572650 1:24317934-24317956 CTGTGTTGGGGGAAGCCCAGGGG - Intergenic
904105165 1:28074418-28074440 TTCTGTTAGGGCAAACCAAGTGG + Intronic
908099537 1:60776708-60776730 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
908637907 1:66189011-66189033 CTCTTTTAGGGCAAGCCTGGTGG + Intronic
908639150 1:66203024-66203046 CTCTTTTAGGGCAAGCCTGGTGG + Intronic
908906195 1:69013454-69013476 CTCAGTTAAAGCAAGCACACAGG - Intergenic
910911211 1:92236285-92236307 CTCTTTTAGGGCAGGCCTGCTGG + Intronic
911106474 1:94136062-94136084 CTCTTTTAGGGCAGGCCCAGTGG - Intergenic
911141808 1:94511168-94511190 CTCTTTTAGGGCAGGCCCGGTGG + Intronic
912613866 1:111077694-111077716 CTCTTTTAGGGCAGGCCCTGTGG + Intergenic
912741577 1:112203323-112203345 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
914987145 1:152470946-152470968 CTCTGATTGATCAAGCCCACTGG + Intergenic
916387363 1:164289728-164289750 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
916487240 1:165270780-165270802 TTCTGTTAGGACCAGCACACAGG + Intronic
917575006 1:176312556-176312578 CTCTTTTAGGGCAAGCCTGGTGG + Intergenic
918041685 1:180917459-180917481 CTCTGGTGGGGCAAGCAGACAGG + Intronic
918517855 1:185382774-185382796 CTCTTTTAGGGCAAGCCTGGTGG + Intergenic
919369789 1:196708702-196708724 CTCTGTTAGGGCAAGCCCACTGG + Intronic
919382347 1:196874708-196874730 CTCTGTTAGGACAAGCTCACTGG + Intronic
922200797 1:223399710-223399732 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
922374203 1:224944669-224944691 CTCTTTTAGGGCAGGCCCGGTGG + Intronic
1064010903 10:11735617-11735639 CTCTTTTAGGGCAGGCCTGCTGG + Intergenic
1065138683 10:22699345-22699367 CTCTCTTAGACCAAGTCCACAGG - Intronic
1066032896 10:31447591-31447613 CTCTTTTAGGGCAGGCCTGCTGG + Intronic
1066034889 10:31471028-31471050 CTCTTTTAGGGCAGGCCTGCTGG - Intronic
1066274107 10:33851927-33851949 CTCTTTTAGGGCAGGCCTGCTGG + Intergenic
1068355256 10:55901468-55901490 CTCTTTTAGGGCAGGCCTGCTGG - Intergenic
1068376537 10:56188062-56188084 CTCTTTTAGGGCAGGCCTGCTGG - Intergenic
1069355739 10:67583235-67583257 CTCTTTTAGGGCAGGCCTGCTGG + Intronic
1071233974 10:83622694-83622716 CTCATTTTGGGTAAGCCCACAGG - Intergenic
1072656030 10:97331158-97331180 CCCTGTTAGGGCAGGCACCCTGG - Intergenic
1073684549 10:105737672-105737694 CTCTTTTAGGGCAGGCCTGCTGG - Intergenic
1074257358 10:111815635-111815657 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
1074303377 10:112252862-112252884 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
1078021750 11:7662324-7662346 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
1078041025 11:7862862-7862884 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
1079577340 11:22020175-22020197 CTCTTTTAGGGCAGGCCTGCTGG + Intergenic
1079628981 11:22651095-22651117 CTCTTTTAGGGCAGGCCTGCTGG + Intronic
1080150769 11:29049810-29049832 CTCTTTTAGGGCAAGCCTGGTGG + Intergenic
1081148927 11:39602583-39602605 CTCTTTTAGGGCAAGCCTGGTGG + Intergenic
1082557090 11:54575555-54575577 CTCTTTTAGGGCAAGCCTGGTGG - Intergenic
1082557973 11:54585491-54585513 CTCTTTTAGGGCAGGCCTGCTGG + Intergenic
1083498123 11:63077130-63077152 CTCTTTTAGGGCAGGCCTGCTGG + Intergenic
1086149194 11:83589455-83589477 CTCTTTTAGGGCAGGCCTGCTGG - Intronic
1087824106 11:102745616-102745638 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
1088414417 11:109572868-109572890 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
1088440715 11:109867278-109867300 CACTGTCATGGCAAGCCCACTGG - Intergenic
1088494795 11:110422000-110422022 CTCTGTTCTGCCCAGCCCACAGG + Intergenic
1089266814 11:117269657-117269679 CTTTGTTAGGCCAAGCACAGTGG - Intronic
1089592729 11:119555096-119555118 CCCTGTTATGGTAAGCCCTCTGG + Intergenic
1090843579 11:130513272-130513294 CTCTGTTTGAGCCAGCACACAGG - Intergenic
1093344651 12:18025729-18025751 CTCTTTTAGGGCAGGCCTGCTGG - Intergenic
1093350371 12:18092560-18092582 CTCTTTTAGGGCAGGCCTAGTGG - Intronic
1093493758 12:19732861-19732883 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
1094073335 12:26444417-26444439 CTCTGTTAGTAGAAGCCCTCAGG - Intronic
1095089816 12:38093279-38093301 CTCTTTTAGGGCAGGCCCGGTGG - Intergenic
1095217561 12:39567802-39567824 CTCTTTTAGGGCAGGCCTAGTGG + Intronic
1095387701 12:41670482-41670504 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
1096943784 12:55381148-55381170 CTCTGTTCCGCCCAGCCCACAGG + Intergenic
1097546287 12:61005262-61005284 CTCTTTTAGGGCAAGCCTGGTGG + Intergenic
1097837835 12:64291528-64291550 CTCTTTTAGGGCAGGCCTAGTGG + Intronic
1098642445 12:72855606-72855628 CTCTGTTAGGGCAGGCCTGGTGG + Intergenic
1099000896 12:77177567-77177589 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
1105520907 13:21130113-21130135 GTCTGGTAGGGAAGGCCCACAGG + Intergenic
1105621608 13:22072841-22072863 CGCTGTTCTGTCAAGCCCACCGG + Intergenic
1106341162 13:28828223-28828245 CTCTGTTCTGCCAAGCCCACAGG + Intronic
1107154794 13:37154134-37154156 CTCTGTTAGGGCAGGCCTGGTGG + Intergenic
1107162928 13:37252175-37252197 CTCTGTTAGGGCAGGCCTGGTGG - Intergenic
1109175874 13:59154711-59154733 CACTGTTAGAGCCAGACCACAGG + Intergenic
1109647154 13:65273779-65273801 CTCTTTTTGCGCAACCCCACAGG - Intergenic
1113206644 13:107924851-107924873 CTCTTTTAGGGCAGGCCTGCTGG + Intergenic
1113482806 13:110634033-110634055 CTCTGAAAGGCGAAGCCCACTGG - Intronic
1115148346 14:30253571-30253593 CACTGTTAGGGAAAGCCCACTGG - Intergenic
1116038531 14:39657831-39657853 CTCTTTTAGGGCAAGCCTGGTGG - Intergenic
1116398425 14:44475350-44475372 CTCTTTTAGGGCAGGCCCGGTGG + Intergenic
1116864057 14:50017166-50017188 CTCAGTTAGGGCAAAACCTCAGG + Intergenic
1117465767 14:55992364-55992386 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
1119007400 14:70944113-70944135 CTCTGTTAGGCCATGCCCAGTGG - Intronic
1121863221 14:97338707-97338729 CTTTGTTAGTGCAAGCCCCAAGG + Intergenic
1124177531 15:27440166-27440188 CCCTGTCAGGGAAAGCCCAGAGG - Intronic
1125925706 15:43561081-43561103 CTCTTTTAGGGCAGGCCTTCTGG + Intronic
1125938850 15:43660632-43660654 CTCTTTTAGGGCAGGCCTTCTGG + Intronic
1130922437 15:88359021-88359043 CTCTTTTAGGGCAGGCCCGGTGG - Intergenic
1131628680 15:94152167-94152189 CTCTTTTAGGGCAAGCCTGGTGG + Intergenic
1134092984 16:11401429-11401451 GTCTGTCTGGGCAAGGCCACTGG - Intronic
1138563341 16:57815344-57815366 TTCTGTTAGCTCAAGGCCACAGG + Intronic
1138942127 16:61803281-61803303 CTCTTTTAGGGCAGGCCTAGTGG - Intronic
1140979164 16:80090246-80090268 CTCTTTTAGGGCAGGCCTGCTGG + Intergenic
1144520058 17:15947306-15947328 CTCTGCCAGGGCAAGTCCAAGGG - Intronic
1145718209 17:27043839-27043861 CTCTTTTAGGGCAGGCCTGCTGG + Intergenic
1147332194 17:39705675-39705697 GGCTGGTAGGGCAAGCCCCCAGG - Intronic
1149058350 17:52391291-52391313 CACTGCTAGGGCAAGCCCAAAGG + Intergenic
1150807715 17:68332281-68332303 CTCTGTTCCGCCCAGCCCACAGG + Intronic
1151228548 17:72665004-72665026 CTCTTTGAAGGCAAGGCCACAGG + Intronic
1151917868 17:77132010-77132032 CTGTGTTAGCTCAAGGCCACTGG + Intronic
1152253091 17:79221806-79221828 CTCTGGCTGGGCAAGCCCAGGGG + Intronic
1155568337 18:27162285-27162307 CTCTTTTAGGGCAAGCCTGGTGG + Intronic
1156725119 18:40118237-40118259 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
1157770337 18:50340019-50340041 CTCTGAGAGGGAAGGCCCACCGG + Intergenic
1159003205 18:62991381-62991403 CCCTGGTGGGGCATGCCCACAGG + Intergenic
1161279625 19:3438772-3438794 CTCAGGTAGGGCCAGCACACAGG - Intronic
1165600542 19:37052538-37052560 CTCTTTTAGGGCAGGCCTGCTGG + Intronic
1165607519 19:37118434-37118456 CTCTTTTAGGGCAGGCCTGCTGG - Intronic
1166367716 19:42285742-42285764 CAGTGTGAGGGGAAGCCCACTGG + Intronic
924963347 2:54856-54878 TTATGTTACAGCAAGCCCACAGG + Intergenic
925060682 2:887707-887729 CTCCGTCAGGGCAGCCCCACAGG - Intergenic
927924138 2:26997941-26997963 CCCCGATAGGGCATGCCCACAGG + Intronic
929947775 2:46383295-46383317 CTCTGGTAGGCCCACCCCACTGG + Intronic
930987765 2:57610652-57610674 CTCTTTTAGGGCAGGCCCGGTGG - Intergenic
931194377 2:60036813-60036835 CTCTTTTAGGGCAGGCCCGGTGG - Intergenic
932644129 2:73484250-73484272 CTCTTTTAGGGCAGGCCTAGTGG + Intronic
932649561 2:73540334-73540356 CTCTTTTAGGGCAGGCCTAGTGG - Intronic
934789661 2:97047978-97048000 CTCTGGTAGGCTAAGCCCAGTGG - Intergenic
934806259 2:97229814-97229836 CTCTTTTAGGGCAAGCCTGGTGG + Intronic
934816805 2:97334561-97334583 CTCTGGTAGGCTAAGCCCAGTGG + Intergenic
934820891 2:97373923-97373945 CTCTGGTAGGCTAAGCCCAGTGG - Intergenic
935142134 2:100362617-100362639 CTCTGTTTTGCCCAGCCCACAGG + Intergenic
935858151 2:107297999-107298021 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
936010153 2:108920358-108920380 CTCTGTTACGGCAGGGCAACGGG + Intronic
937063876 2:119002510-119002532 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
938151580 2:128889752-128889774 CTCTGTTTGGGCAGGCTCAGTGG - Intergenic
938445616 2:131375241-131375263 CTCTTTTAGGGCAAGCCTGGCGG - Intergenic
938667019 2:133548693-133548715 CTCTTTTAGGGCAGGCCTAGTGG - Intronic
938788365 2:134654724-134654746 CTCTTTTAGGGCAGGCCTAGTGG + Intronic
939157489 2:138542912-138542934 CTCTTTTAGGGCAAGCCTGGTGG + Intronic
939660761 2:144886913-144886935 CTCTGGGAGTGCAAGCCCATGGG + Intergenic
940632461 2:156256343-156256365 CTCTTTTAGGGCAGGCCTGCTGG - Intergenic
940741787 2:157516972-157516994 CTCTTTTAGGGCAGGCCTGCTGG - Intergenic
942214290 2:173703559-173703581 CTCTTTTAGGGCAGGCCTGCTGG + Intergenic
943109551 2:183588144-183588166 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
943130855 2:183851347-183851369 CTCTTTTAGGGCAAGCCTGGTGG - Intergenic
945602934 2:211890370-211890392 CTCTTTTAGGGCAGGCCTAGTGG - Intronic
948012842 2:234663766-234663788 CTCTGTTCTGCCCAGCCCACAGG - Intergenic
948076703 2:235170616-235170638 CTGTCTTAAGACAAGCCCACTGG + Intergenic
1170265786 20:14465710-14465732 CTCTTTTAGGGCAGGCCTAGTGG + Intronic
1172335331 20:34111481-34111503 CTCTGTTAAGGGAAGCTCAGGGG + Intronic
1172486028 20:35298283-35298305 CTCTCTAAGGCCAAGCCCAGTGG + Intergenic
1174952420 20:55056749-55056771 CTCTGTTAGAGAAAGACCTCTGG + Intergenic
1175820001 20:61904071-61904093 CCCCGCTGGGGCAAGCCCACAGG - Intronic
1176758107 21:10741472-10741494 CTCTTTTAGGGCAGGCCTGCTGG - Intergenic
1183401564 22:37608092-37608114 GTGTGATAGGGGAAGCCCACGGG - Intergenic
1184981865 22:48100851-48100873 CCCTGCAGGGGCAAGCCCACTGG - Intergenic
950807606 3:15620448-15620470 CTCTTTTAGCCCAACCCCACAGG + Intronic
951474537 3:23091484-23091506 CTCTTTTAGGGCAGGCCTGCTGG + Intergenic
951572803 3:24083126-24083148 CTCTTTTAGGGCAGGCCTGCTGG + Intergenic
959103657 3:102041874-102041896 CTCTTTTAGGGCAAGCCTGGTGG - Intergenic
960850251 3:122046095-122046117 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
960919832 3:122734838-122734860 CTCTTTTAGGGCAGGCCCGGTGG - Intergenic
961355155 3:126333386-126333408 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
961667753 3:128504263-128504285 CTCTGGAAGGGCAAGACCTCTGG - Intergenic
962851901 3:139314276-139314298 CTCTGTCAGGGGAAGCCAGCAGG + Intronic
963435048 3:145256798-145256820 CTCTTTTAGGGCAGGCCCGGTGG + Intergenic
964540618 3:157775250-157775272 CTCTGATAGGGAAAGGCAACAGG + Intergenic
964959906 3:162410045-162410067 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
965021644 3:163238764-163238786 CTCTGTTAGGGCAGGCCTGGTGG - Intergenic
966662319 3:182427919-182427941 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
968717627 4:2173172-2173194 TTCTGATAGGGAAAGCACACAGG + Intronic
969992131 4:11275553-11275575 CTTTGTTAGAGGAAGCCCAGGGG - Intergenic
970022128 4:11581555-11581577 CTCTTTTAGGGCAAGCCTGGTGG + Intergenic
970220005 4:13800360-13800382 CTCTTTTAGGGCAAGCCTGGTGG - Intergenic
972376712 4:38478428-38478450 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
974143680 4:57920034-57920056 CTCTTTTAGGGCAAGCCTGGTGG - Intergenic
974199414 4:58619982-58620004 CTCTGTTCTGCCCAGCCCACAGG - Intergenic
976051137 4:81012537-81012559 CTCTGCTAGGGCAAGGCAAAAGG + Intergenic
977485200 4:97635305-97635327 CTCTTTTAGGGCAGGCCTAGTGG - Intronic
978012935 4:103709471-103709493 CTCTTTTAGGGCAGGCCTAGTGG - Intronic
978022429 4:103830623-103830645 CTCTTTTAGGGCAAGCCTTGTGG + Intergenic
979317125 4:119278277-119278299 CTCTTTTAGGGCAGGCCTAGTGG + Intronic
979440347 4:120743244-120743266 CTCTTTTAGGGCAGGCCTAGTGG - Intronic
982052260 4:151513267-151513289 CTCTTTTAGGGCAAGCCTGGTGG - Intronic
982836355 4:160124392-160124414 CTCTTTTAGGGCAAGCCTCGTGG + Intergenic
983171866 4:164545190-164545212 CTCTTTTAGGGCAAGCCTGGTGG - Intergenic
983173060 4:164557673-164557695 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
983173853 4:164565057-164565079 CTCTTTTAGGGCAAGCCTGGTGG - Intergenic
983687967 4:170433249-170433271 CTCTTTTAGGGCAGGCCTGCTGG - Intergenic
985439087 4:189965665-189965687 CTCTGTTAGGGCAGGCCTGCTGG - Intergenic
986090532 5:4500523-4500545 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
986769187 5:10956377-10956399 CTTTGTTATGGCAGCCCCACAGG - Intergenic
987678798 5:21109240-21109262 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
988284201 5:29190759-29190781 CTCTTTTAGGGCAGGCCTGCTGG + Intergenic
989355924 5:40543134-40543156 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
989656132 5:43747388-43747410 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
989725396 5:44580753-44580775 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
989733049 5:44670330-44670352 CTCTTTTAGGGCAGGCCTGCTGG - Intergenic
989771501 5:45151909-45151931 CTCTGTTCCGCCCAGCCCACAGG - Intergenic
989787474 5:45348331-45348353 CTCTTTTAGGGCAGGCCTGCTGG - Intronic
989809893 5:45660268-45660290 CTCTTTTAGGGCAGGCCTGCTGG - Intronic
990316653 5:54589291-54589313 CTCTGGAAGGGAAAGGCCACAGG - Intergenic
990692086 5:58375755-58375777 CTCTTTTAGGGCAGGCCTGCTGG + Intergenic
990706918 5:58540312-58540334 CTCTTTTAGGGCAGGCCCGGTGG + Intergenic
990868065 5:60401515-60401537 CCCTCTCACGGCAAGCCCACGGG + Intronic
991451180 5:66752109-66752131 CTCTTTTAGGGCAGGCCTAGTGG - Intronic
992756659 5:79912936-79912958 CTCTTGTAAGGCAAGCCCAGTGG - Intergenic
992898384 5:81267966-81267988 ATCTTTTAGGGCAAGCCAACAGG + Intergenic
993030208 5:82696839-82696861 CTCTGAATGGGGAAGCCCACAGG + Intergenic
994036783 5:95210851-95210873 CTCTTTTAGGGCAGGCCTAGTGG + Intronic
995204105 5:109459205-109459227 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
996122561 5:119688967-119688989 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
996130790 5:119778941-119778963 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
998009463 5:138682856-138682878 CTCTCTTAGGGCAGGCCCGGTGG + Intronic
999814406 5:155161774-155161796 CTCTTTTAGGGCAAGCCTGGTGG + Intergenic
1004133191 6:12940987-12941009 CTCTTTAAGGCCAAGCCCCCAGG - Intronic
1006292739 6:33152517-33152539 CTCTTTTAGCCCAACCCCACAGG + Intergenic
1006395088 6:33782051-33782073 CTGTGTTAGGGGAAGGCGACAGG - Intronic
1006408074 6:33856659-33856681 CTCTGCTCTGGCAAGCCCTCGGG + Intergenic
1007873164 6:45064274-45064296 CTCTTTTAGGGCAGGCCTAGTGG - Intronic
1008796531 6:55310287-55310309 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
1008798937 6:55342489-55342511 CTCTTTTAGGGCAGGCCTAGTGG - Intronic
1009341074 6:62555537-62555559 CTCTTTTAGGGCAGGCCTGCTGG - Intergenic
1010551252 6:77224672-77224694 CTCTGTTAGGCAAACCCCAGAGG + Intergenic
1010834664 6:80572096-80572118 CTCTTTTAGGGCATGCCCTGTGG + Intergenic
1011244321 6:85306401-85306423 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
1011387146 6:86810836-86810858 CTCTTTTAGGGCAGGCCTGCTGG + Intergenic
1011435018 6:87327431-87327453 CTCTTTTAGGGCAGGCCTGCTGG + Intronic
1011528316 6:88291115-88291137 CTCTTTAAGGGCAAGCCTGCTGG - Intergenic
1012285252 6:97380710-97380732 CTCTTTTAGGGCAGGCCTGCTGG + Intergenic
1012969933 6:105718080-105718102 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
1013889587 6:115010279-115010301 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
1014584488 6:123181956-123181978 CTCTTTTAGGGCAGGCCTGCTGG - Intergenic
1015846379 6:137524763-137524785 CTCTGGTAGGCCAAGGCCAGTGG + Intergenic
1020615764 7:10458717-10458739 CTCTGTTCCGCCCAGCCCACAGG + Intergenic
1021671335 7:23037556-23037578 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
1022025940 7:26447950-26447972 ATGTGTTGGGGCAAGCCCAAGGG - Intergenic
1022929415 7:35094783-35094805 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
1022934084 7:35153765-35153787 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
1023747843 7:43338853-43338875 TTCTTTTAGTGCAATCCCACTGG + Intronic
1024880334 7:54078588-54078610 CTATGTTAGGGAAAGTTCACGGG + Intergenic
1025749519 7:64281225-64281247 CTCTGTTCCGCCCAGCCCACAGG + Intergenic
1027350837 7:77309384-77309406 GTCTGTTAGGGGTAGCCCATGGG + Intronic
1027416788 7:77982734-77982756 GTCTCTTAGGACAAGCCCAGAGG + Intergenic
1027647869 7:80827050-80827072 CTTTGTTTGGAAAAGCCCACAGG + Intronic
1028497697 7:91480851-91480873 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
1029979642 7:104866040-104866062 CTCTTTTAGGGCAGGCCTAGTGG - Intronic
1030008645 7:105143331-105143353 CTATGTTAAGGAAAGACCACAGG + Intronic
1030451767 7:109721072-109721094 CTCTTTTAGGGCAAGCCTGGTGG - Intergenic
1030466556 7:109910026-109910048 CTCTTTTAGGGCAGGCCTGCTGG - Intergenic
1031285086 7:119856760-119856782 CTCTTTTAGGGCAGGCCTGCTGG - Intergenic
1032994132 7:137426364-137426386 CTCTTTTAGGGCAGGCCTGCTGG - Intronic
1034083412 7:148301723-148301745 CTTTGTTAAGGCCATCCCACTGG - Intronic
1035704130 8:1661941-1661963 CTCTGCCAGAGCAAGACCACAGG + Intronic
1037255283 8:16945795-16945817 CTCTTTTAGGGCAGGCCTGCTGG - Intergenic
1040018863 8:42722416-42722438 CTCTGCTTCGGCAAGGCCACGGG - Intronic
1042508576 8:69587946-69587968 CATTGTTAGGGCAAGTCTACAGG - Intronic
1042683129 8:71408187-71408209 CTCTTTTAGGGCAGGCCTAGTGG - Intronic
1046812791 8:118550493-118550515 CTCTTTTAGGGCAGGCCTGCTGG - Intronic
1046828827 8:118721893-118721915 CTCTTTTAGGGCAGGCCTGCTGG + Intergenic
1046867123 8:119163575-119163597 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
1047799999 8:128298875-128298897 GTCTTTTAGGGTAAGCCCAGAGG - Intergenic
1051161468 9:14213439-14213461 CTCTGTTAGGACAAGCTCTCTGG - Intronic
1051458569 9:17289185-17289207 CTCTTTTAGGGCAGGCCTAGTGG + Intronic
1051945966 9:22570425-22570447 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
1053285763 9:36848646-36848668 CTCTGATAGGGCAGGTCCACGGG - Intronic
1054347508 9:63981631-63981653 CTCTTTTAGGGCAAGCCTGGTGG - Intergenic
1054445237 9:65307974-65307996 CTCTTTTAGGGCAAGCCTGGTGG - Intergenic
1054485034 9:65713532-65713554 CTCTTTTAGGGCAAGCCTGGTGG + Intronic
1054785294 9:69204299-69204321 CGCTGTTTGGCCAAGCCCATTGG + Intronic
1055280337 9:74666769-74666791 CTCTGTTAGTGCCTTCCCACAGG - Intronic
1056631521 9:88297119-88297141 CTCTTTTAGGGCAGGCCTAATGG + Intergenic
1061090613 9:128424013-128424035 CTCTGTAAGAGCATTCCCACTGG + Intronic
1061484743 9:130914563-130914585 CCCTGGTTGGGCACGCCCACTGG - Intronic
1062368816 9:136226010-136226032 ACCTGTTAGGGCAGGACCACAGG + Intronic
1186810036 X:13179236-13179258 CTCTTTTTGGGCTAGCTCACAGG + Intergenic
1187364413 X:18654712-18654734 GTCTGATAGGAAAAGCCCACCGG + Intronic
1187493208 X:19772279-19772301 CGCTGTTAGGGGAAATCCACTGG + Intronic
1188525230 X:31081495-31081517 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
1189062660 X:37770560-37770582 CTCTTTTAGGGCAGGCCCGGTGG - Intronic
1190608821 X:52172731-52172753 CTCTTTTAGGGCAGGCCCAGTGG - Intergenic
1190935169 X:54993266-54993288 GTCTCTCAGGGCCAGCCCACTGG - Intronic
1191072756 X:56419744-56419766 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
1191192959 X:57686201-57686223 CTCTTTTAGGGCAGGCCCGGTGG - Intergenic
1191660863 X:63648415-63648437 CTCTTTTAGGGCAGGCCTGCTGG - Intronic
1191960035 X:66691159-66691181 CTCTTTTAGGGCAGGCCCAGTGG + Intergenic
1192683897 X:73283310-73283332 CTCTGTTAGGGCAGGCCTGATGG - Intergenic
1192685777 X:73303809-73303831 CTCTGTTAGGGCAGGCCTGATGG + Intergenic
1193059969 X:77195639-77195661 CTCTGGTAAGGCAAGCCTGCTGG + Intergenic
1193071104 X:77306395-77306417 CTCTTTTAGGGCAGGCCCAGTGG - Intergenic
1193346210 X:80407065-80407087 CTCTTTTAGGGCAGGCCTGCTGG - Intronic
1194231982 X:91335729-91335751 CTCTTTTAGGGCAGGCCCGGTGG + Intergenic
1195125909 X:101809864-101809886 CTCTGTTAGGGCAGGCCTGGTGG + Intergenic
1195147657 X:102033391-102033413 CTCTTTTAGGGCAGGCCCGGTGG - Intergenic
1195170698 X:102265248-102265270 CTCTGTTAGGGCAGGCCTGGTGG - Intergenic
1195188161 X:102421851-102421873 CTCTGTTAGGGCAGGCCTGGTGG + Intronic
1195247291 X:103005912-103005934 CTCAGGTAAGGCAAGCCCCCAGG - Intergenic
1197001059 X:121439466-121439488 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
1197008736 X:121535384-121535406 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
1197057843 X:122141956-122141978 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
1197071085 X:122298758-122298780 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
1199060862 X:143353845-143353867 CTCTTTTAGGGCAGGCCTGCTGG + Intergenic
1199546215 X:149009539-149009561 CTCTGTGAGGGCATACCCAAAGG + Intergenic
1199588126 X:149437639-149437661 CTCTTTTAGGGCAGGCCTAGTGG - Intergenic
1200426836 Y:3031023-3031045 CTCTTTTAGGGCAGGCCTGCTGG + Intergenic
1200930047 Y:8688773-8688795 CTCTGTTAAGGCAGGCTGACAGG - Intergenic
1201525006 Y:14923152-14923174 CTCTTTTAGGGCAGGCCTGCTGG - Intergenic
1201860414 Y:18591713-18591735 CTCTTTTTGCCCAAGCCCACAGG - Intergenic
1201872909 Y:18728668-18728690 CTCTTTTTGCCCAAGCCCACAGG + Intergenic
1201945738 Y:19508204-19508226 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
1202085021 Y:21127693-21127715 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic
1202088068 Y:21160009-21160031 CTCTTTTAGGGCAGGCCTAGTGG + Intergenic