ID: 919376496

View in Genome Browser
Species Human (GRCh38)
Location 1:196800902-196800924
Sequence CCTCAAATACTGGGGATAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
919376496_919376502 -7 Left 919376496 1:196800902-196800924 CCTTCTATCCCCAGTATTTGAGG No data
Right 919376502 1:196800918-196800940 TTTGAGGGTTTTCATCATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
919376496 Original CRISPR CCTCAAATACTGGGGATAGA AGG (reversed) Intergenic
No off target data available for this crispr